ID: 1175434890

View in Genome Browser
Species Human (GRCh38)
Location 20:58938204-58938226
Sequence CAAAGCTCCCTGGCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175434890_1175434893 14 Left 1175434890 20:58938204-58938226 CCAGTCTTTGCCAGGGAGCTTTG No data
Right 1175434893 20:58938241-58938263 CATGCCTTCAATACTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175434890 Original CRISPR CAAAGCTCCCTGGCAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr