ID: 1175438984

View in Genome Browser
Species Human (GRCh38)
Location 20:58977506-58977528
Sequence GAAGAATTCTGGGCCGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175438984_1175438990 17 Left 1175438984 20:58977506-58977528 CCGCACCCGGCCCAGAATTCTTC No data
Right 1175438990 20:58977546-58977568 TTTAGAACTTAAATGACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175438984 Original CRISPR GAAGAATTCTGGGCCGGGTG CGG (reversed) Intergenic
No off target data available for this crispr