ID: 1175439480

View in Genome Browser
Species Human (GRCh38)
Location 20:58980994-58981016
Sequence GCTCGCAGAGCCGGCGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175439474_1175439480 2 Left 1175439474 20:58980969-58980991 CCAGCTGCCAGATGAGGAAACTG No data
Right 1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 147
1175439472_1175439480 18 Left 1175439472 20:58980953-58980975 CCGGAAGGATTTGTTTCCAGCTG No data
Right 1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 147
1175439478_1175439480 -5 Left 1175439478 20:58980976-58980998 CCAGATGAGGAAACTGGGGCTCG No data
Right 1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 147
1175439471_1175439480 29 Left 1175439471 20:58980942-58980964 CCTGGACACTTCCGGAAGGATTT No data
Right 1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175439480 Original CRISPR GCTCGCAGAGCCGGCGCCGC AGG Intergenic
900090162 1:916748-916770 GCTCCCGGGGCCGGCGCCGAGGG + Intergenic
900105628 1:979663-979685 GTTCCCAGAGCCGACGCCGCTGG - Exonic
900117425 1:1034531-1034553 GGGCGCAGAGCCGGAGCCCCGGG + Intronic
900123826 1:1060741-1060763 CCTCGCAGAGAAGGCGCCACTGG + Intergenic
900911570 1:5600286-5600308 GCTAGCAGAGCCCGGGCCTCAGG - Intergenic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
903297040 1:22350562-22350584 GCTGGCAGAGCCGGCCAGGCTGG + Intergenic
904045139 1:27604128-27604150 GCTCGCAGAGGCAGCGGCGGCGG - Intronic
906038514 1:42767603-42767625 GCTCGCAGAGCAGGTGCAGAAGG + Exonic
908355854 1:63324121-63324143 GCGGGCACAGCGGGCGCCGCGGG + Exonic
909433312 1:75614981-75615003 GGTCGCAGAGCCGGCGCGCGGGG - Intergenic
913451076 1:118993082-118993104 GCCGGCAGAGCCGGGGCCGGCGG + Intergenic
914900910 1:151710570-151710592 GCTTGCAGAGCAGGCCCTGCAGG + Intronic
914902360 1:151717486-151717508 GGCCGCGGAGGCGGCGCCGCGGG + Intronic
915544930 1:156591779-156591801 GCTCGCAGAGCGCGCGCCCCCGG - Exonic
922925145 1:229342195-229342217 GCCCGTAGAGCCGGCGACCCAGG - Exonic
923490447 1:234479053-234479075 TCTCGCAGAGCCGGGACCCCCGG - Exonic
924436921 1:244049642-244049664 GGGCGCAGAGCCGGTGCAGCAGG - Intronic
1062895005 10:1096692-1096714 GCGCGCAGAGCGGGGGCTGCTGG + Intronic
1066135891 10:32446073-32446095 GCTCGCAGCGTCAGCGACGCCGG + Intergenic
1067147340 10:43703094-43703116 GCTCGCTCAGCAGGCGCGGCTGG + Intergenic
1067801309 10:49361246-49361268 TCTGGCAGAGCCGGCCCCCCTGG - Intergenic
1071532550 10:86400904-86400926 CCCCGCAGTGCCGGCGCCTCTGG + Intergenic
1073930234 10:108566801-108566823 GCTCGCAGAGACGTCACCCCTGG + Intergenic
1081908110 11:46681995-46682017 GCTGGCAGAGCCGCTGCCTCTGG + Intronic
1089557286 11:119321375-119321397 GATGGCAGCGTCGGCGCCGCGGG + Intronic
1093652130 12:21657821-21657843 CCTTGCAGAGCCGGCGCCGGAGG - Intronic
1095875873 12:47079775-47079797 GCTCCCAGAGCCGGGGCCGCGGG + Exonic
1096789027 12:54033900-54033922 GCCGGCGGAGCCGGCTCCGCAGG - Intronic
1101144754 12:101830724-101830746 GCTCGCTGAGGCGGCGGCGGCGG - Exonic
1102197415 12:111034873-111034895 GCCGCCAGAGCCGCCGCCGCCGG + Intronic
1102969507 12:117155329-117155351 GCTCCCAGGGCCGGCGCAGTGGG + Intronic
1103364015 12:120369339-120369361 GCCCGCGGAGGCGGCGGCGCCGG + Intergenic
1103828726 12:123762215-123762237 GCCCCCAGCGCCGGCGCCGTCGG + Intergenic
1104918263 12:132277653-132277675 GCCAGCAGAGCCGGGGCCGCGGG - Intronic
1110119614 13:71865826-71865848 GCGCGCAGAGCGAGCGGCGCCGG + Intronic
1113894166 13:113752827-113752849 GGCCACAGAGCCGGCGCGGCCGG - Intergenic
1119330137 14:73787302-73787324 GCGCGCGGAGCCGGGGGCGCGGG - Intronic
1121199582 14:92106316-92106338 GCTCCCAGGGCGGGGGCCGCGGG + Intronic
1124370760 15:29103605-29103627 GCCCGGGGAGCCGGCTCCGCGGG - Intronic
1129726962 15:77906298-77906320 GCTGGCAGAGCCTGCCCCCCAGG + Intergenic
1130275311 15:82473103-82473125 GCTGGCAGAGCCTGCCCCCCAGG + Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1130467671 15:84200498-84200520 GCTGGCAGAGCCTGCCCCCCAGG + Intergenic
1130496594 15:84473044-84473066 GCTGGCAGAGCCTGCCCCCCAGG - Intergenic
1130589963 15:85205096-85205118 GCTGGCAGAGCCTGCCCCCCAGG + Intergenic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132713734 16:1280341-1280363 GCTCCCACAGCCGACGCCGAGGG + Intergenic
1134099613 16:11442777-11442799 GATTGCAGAGCCGGCGCCATGGG - Intronic
1136365146 16:29806320-29806342 GCGCGCCCAGCCGGCGCCTCGGG - Intronic
1137300353 16:47143390-47143412 GCCCGGAGAGCCGGCGGAGCCGG + Intronic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1142225779 16:88877033-88877055 CCCCGCAGAGCCGGCTTCGCTGG + Exonic
1142395384 16:89828708-89828730 GCTCGCCGGGCCGGCGCCTGCGG + Exonic
1142767880 17:2075880-2075902 GCTCTCAGAGCCTGTGCAGCTGG - Intronic
1142851793 17:2707987-2708009 CCTGGCAGAGCCGGGGCTGCTGG - Intronic
1142876398 17:2853932-2853954 GCGCGCGGAGCCGGGGCTGCGGG + Intronic
1144107285 17:11997436-11997458 GCGCCCGGAGCCGGCGCCGCGGG - Intronic
1146022696 17:29293098-29293120 CCCCCCAGAGCCGGCGCGGCTGG - Intronic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1149997553 17:61412784-61412806 GGTCGCCGAGCTGGCGCTGCCGG - Exonic
1150904831 17:69326754-69326776 CCTCGCGGAGCCCCCGCCGCAGG + Intronic
1151291879 17:73156351-73156373 GCTCGCAGAGGCCGCCCCGGAGG + Intergenic
1151969867 17:77452029-77452051 GATCCCAGTGCCGGCGCCGCGGG - Intronic
1152544123 17:80992212-80992234 GCTCGCAGAGGCGGACGCGCGGG - Intronic
1152668064 17:81582975-81582997 GTGCGCAGGGGCGGCGCCGCAGG - Intronic
1154266609 18:12884162-12884184 GCGAGCAGAGCCTGCGCCGGCGG + Exonic
1157095145 18:44680366-44680388 GCCAGCGGAGCCGGAGCCGCCGG + Intronic
1157529540 18:48409503-48409525 GCCCCCCGAGCCGGCGGCGCGGG - Intronic
1160211054 18:76880223-76880245 GCTCTCAGAGCCGGCGCCGGTGG + Exonic
1160450862 18:78965273-78965295 GCTCCCAGAGAAGGCGGCGCTGG - Intergenic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1161045669 19:2133106-2133128 GCTTGCAGAGACGGCGGTGCTGG + Intronic
1161117138 19:2503968-2503990 GCTCACGGAGCCGGCGTCTCAGG - Intergenic
1161978728 19:7619813-7619835 GCTGGCAGAGCTGGCACAGCAGG - Exonic
1162100332 19:8335070-8335092 GCTCGGTGAGCCGCCGCAGCTGG + Exonic
1163311737 19:16519108-16519130 GGTCCCACAGCCGGCACCGCTGG + Exonic
1165639392 19:37371201-37371223 GTTTGCAGAGCCCGCGGCGCCGG + Exonic
1168401279 19:56087446-56087468 GGTAGCAGAGGCAGCGCCGCAGG - Exonic
928299850 2:30115445-30115467 GATACCAGAGCCGGCGCTGCAGG - Intergenic
932607655 2:73175773-73175795 GCTTGCAGAGCCGGGGCCCCGGG + Intergenic
935137876 2:100322747-100322769 GCTCGCTGAGGCGGGGCCTCTGG - Intergenic
944413608 2:199463593-199463615 ACCGGCAGAGCCGGCGCCGAAGG - Intronic
948933626 2:241148981-241149003 GCGGGCTCAGCCGGCGCCGCGGG - Intronic
1168777739 20:462252-462274 GCTGGCGGAGGCGGCGCCGGAGG - Intronic
1168854946 20:1001999-1002021 GCCCCCAGAGCCGCCGCCCCCGG + Intronic
1168965256 20:1894784-1894806 GCTCGCAGAGAAGGTGCCGGCGG + Intronic
1174035635 20:47666641-47666663 GCTCGCAGATCCTGGACCGCAGG + Intronic
1175198794 20:57264611-57264633 GATCTCAGAGCTGACGCCGCGGG - Intronic
1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG + Intergenic
1175783860 20:61699998-61700020 GCTCACAGCGCCGGAGCTGCAGG + Intronic
1176075580 20:63246888-63246910 GCTCACAGAGGCGGCACAGCGGG + Intronic
1176370227 21:6057956-6057978 GCTCTCAGAGCCGGCCAGGCGGG - Intergenic
1176547496 21:8208129-8208151 GCCCGCAGAGGCGGCGGCTCCGG - Intergenic
1176555404 21:8252338-8252360 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1176566447 21:8391176-8391198 GCCCGCAGAGGCGGCGGCTCCGG - Intergenic
1176574322 21:8435363-8435385 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1176610934 21:8986655-8986677 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1179753292 21:43480585-43480607 GCTCTCAGAGCCGGCCAGGCGGG + Intergenic
1181745456 22:24952705-24952727 GCTCCCAGGGCAGGTGCCGCGGG + Intergenic
1182151588 22:28030914-28030936 GCTAGCAGGGCAGGCACCGCTGG + Intronic
1183247291 22:36703549-36703571 GCGCGCGGAGCGGGCGGCGCAGG - Exonic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1183649426 22:39145591-39145613 GCTCGCGGCGCCGGCGGGGCGGG + Intronic
1184033987 22:41910066-41910088 GGTCGCGGAGCCCGCGCCGGGGG + Exonic
1185185972 22:49400446-49400468 CCTCGCAGAGCCTCCGCCCCGGG + Intergenic
1203252368 22_KI270733v1_random:124414-124436 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1203260425 22_KI270733v1_random:169500-169522 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
952423198 3:33149401-33149423 GCTCGCAGTGCCTGTGCTGCTGG + Intergenic
954882638 3:53846173-53846195 GCGCGGGGCGCCGGCGCCGCCGG - Exonic
963882679 3:150546217-150546239 GCTCGTGGTGCCCGCGCCGCCGG + Exonic
966355108 3:179071646-179071668 GCGCGCAGGGCGGGCGTCGCGGG - Exonic
968512662 4:1002481-1002503 GCTGGGTGAGCCGGGGCCGCTGG + Exonic
970456278 4:16226766-16226788 TCCCGCAGAGCGGGCGCCTCCGG + Intronic
972396691 4:38664193-38664215 GCTCGCAGAGCGAGCGGCGCCGG + Exonic
983158634 4:164383559-164383581 GCGCGCAGAGCGGGCGCTGGGGG + Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
988823979 5:34915924-34915946 GCGCACAGAGCCGCCGCCGCAGG - Exonic
994648407 5:102498212-102498234 GCACGCAGAGCCGGCTGTGCGGG - Intronic
998491624 5:142551852-142551874 GCTTCCAGCGCCGGCGCCCCGGG + Intergenic
1001308900 5:170596589-170596611 GCTGGCAGAGCTGGCGCTCCTGG - Intronic
1003071561 6:2949197-2949219 GATGGCAGAGCAGGCGCTGCCGG - Intronic
1003551998 6:7108364-7108386 GTTGGCAGAGCCGGCGGCTCGGG - Intronic
1005685687 6:28251557-28251579 GCTGGATGAGCCGGCGCCGCAGG - Exonic
1005696922 6:28359967-28359989 GCTGGATGAGCCGGCGCCGCAGG + Exonic
1007630312 6:43269755-43269777 GCCCGAGGAGCCGCCGCCGCCGG - Intronic
1013272483 6:108557803-108557825 GCTGGCATAGCCGGCGGCCCGGG - Intergenic
1013272496 6:108557865-108557887 GCCCGGAGAGGCCGCGCCGCGGG + Intergenic
1013422534 6:109979227-109979249 GCTCCTAGAGCCGCCGCAGCAGG - Exonic
1017929408 6:158939173-158939195 GGCCGCAGTGCCGGGGCCGCAGG - Intergenic
1018064039 6:160113429-160113451 GCTTCCAGAGACGGCGCTGCAGG - Intronic
1019011130 6:168844289-168844311 ACTCACAGAGCCGGCGTCGGTGG - Intergenic
1019503487 7:1377568-1377590 GCTCTCAGACCCGGCACTGCTGG - Intergenic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1020771704 7:12403744-12403766 CGTCGCAGAGCCCGGGCCGCGGG + Exonic
1022207881 7:28180596-28180618 GCTCGCAGAGCCGACACCAGGGG - Exonic
1025025462 7:55512930-55512952 GTTGGCAGAGCCAGCACCGCTGG - Intronic
1026470948 7:70694010-70694032 GCGCGCCGAGCCCGAGCCGCCGG - Intronic
1034267975 7:149790332-149790354 GGTCGCAGCGCCAGCCCCGCGGG - Intergenic
1035775141 8:2182066-2182088 GCTTGCAGAGCCGCCCCTGCCGG - Intergenic
1037769354 8:21789594-21789616 GCGCGCGGGGCCGGCGCCGAAGG - Intronic
1039542487 8:38382921-38382943 CCTCGGCGAGCCGGCGCCGCCGG - Intergenic
1039843307 8:41308757-41308779 CCTCGCAGAGCCAGCGACACGGG + Exonic
1043387763 8:79765411-79765433 GCTCGCAAAGCAGGCGCCTCCGG + Exonic
1043442115 8:80285335-80285357 GCTCGCAGGGCTGGCACCGAGGG + Intergenic
1048868642 8:138779526-138779548 GCTGGGAGAGCCGGGGCTGCCGG - Exonic
1049689832 8:143953587-143953609 GGTCGCTGAGCCAGAGCCGCAGG - Intronic
1049721030 8:144115646-144115668 GCCCGGAGAGCCGCCGCCGCTGG + Exonic
1049759861 8:144327037-144327059 GCTCCCAGGGCCGGGGCTGCGGG + Intergenic
1053725143 9:40991973-40991995 GCTCCCAGACGCGCCGCCGCAGG + Intergenic
1054775792 9:69122328-69122350 GCCCGCTGAGCCTCCGCCGCGGG + Intronic
1057173013 9:92975158-92975180 CCCCGCAGAGCCGGGGCCTCTGG + Intronic
1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG + Exonic
1061144054 9:128787044-128787066 GCCCGCAGGGTCGGCGGCGCTGG + Intergenic
1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG + Intronic
1062475242 9:136723462-136723484 GCTCGCAGCGGCGGCCCTGCAGG - Exonic
1062549039 9:137077634-137077656 GCTGGCGGAGCTGGCGCTGCTGG + Exonic
1203468773 Un_GL000220v1:107565-107587 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1203476594 Un_GL000220v1:151537-151559 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1185893396 X:3838933-3838955 TCTTGCAGAGCCCGCGCCACTGG + Intronic
1185898512 X:3877357-3877379 CCTTGCAGAGCCCGCGCCACTGG + Intergenic
1185903627 X:3915786-3915808 CCTTGCAGAGCCCGCGCCACTGG + Intergenic
1187181460 X:16946988-16947010 GCGCGCTGTGCCGGCGCCGCGGG + Exonic
1200093002 X:153644453-153644475 GCGCCCAGAGCCGGCGCTACAGG + Intronic
1200158748 X:153993304-153993326 GGTTGCCGAGCCGGCCCCGCTGG + Intergenic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic