ID: 1175440811

View in Genome Browser
Species Human (GRCh38)
Location 20:58989895-58989917
Sequence CAGCACGGACATCATGGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175440811_1175440818 -7 Left 1175440811 20:58989895-58989917 CCCAGGCCATGATGTCCGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1175440818 20:58989911-58989933 CGTGCTGGCCCAGGAGGAGCAGG 0: 1
1: 0
2: 1
3: 41
4: 402
1175440811_1175440825 13 Left 1175440811 20:58989895-58989917 CCCAGGCCATGATGTCCGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1175440825 20:58989931-58989953 AGGGGGGCTCCGCTGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 140
1175440811_1175440827 23 Left 1175440811 20:58989895-58989917 CCCAGGCCATGATGTCCGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1175440827 20:58989941-58989963 CGCTGTGCGCAGGATCGCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 53
1175440811_1175440820 -5 Left 1175440811 20:58989895-58989917 CCCAGGCCATGATGTCCGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1175440820 20:58989913-58989935 TGCTGGCCCAGGAGGAGCAGGGG 0: 1
1: 0
2: 6
3: 84
4: 649
1175440811_1175440821 -4 Left 1175440811 20:58989895-58989917 CCCAGGCCATGATGTCCGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1175440821 20:58989914-58989936 GCTGGCCCAGGAGGAGCAGGGGG 0: 1
1: 1
2: 17
3: 138
4: 1037
1175440811_1175440822 -3 Left 1175440811 20:58989895-58989917 CCCAGGCCATGATGTCCGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1175440822 20:58989915-58989937 CTGGCCCAGGAGGAGCAGGGGGG 0: 1
1: 1
2: 12
3: 129
4: 747
1175440811_1175440819 -6 Left 1175440811 20:58989895-58989917 CCCAGGCCATGATGTCCGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1175440819 20:58989912-58989934 GTGCTGGCCCAGGAGGAGCAGGG 0: 1
1: 0
2: 3
3: 56
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175440811 Original CRISPR CAGCACGGACATCATGGCCT GGG (reversed) Exonic
900266909 1:1761942-1761964 CAGCACTCACATGATGGTCTGGG + Exonic
900817312 1:4858485-4858507 CAGCAAGGTCATCCTGGGCTTGG - Intergenic
901102378 1:6728734-6728756 CACCAGGGAAAGCATGGCCTTGG + Intergenic
903885246 1:26537223-26537245 CTGCAGGGGCATCCTGGCCTGGG - Intronic
904793742 1:33043406-33043428 CAGCCTGGGCAACATGGCCTGGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906657890 1:47561931-47561953 CAGCAGGGACATCATAGTCCAGG + Intergenic
907027834 1:51138981-51139003 AAGAAAAGACATCATGGCCTGGG - Intronic
909137484 1:71819890-71819912 TAGCACATACATAATGGCCTTGG - Intronic
912388003 1:109282164-109282186 CAGCATGGGCATCGGGGCCTAGG - Intronic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
1069722478 10:70558555-70558577 CAGCACACACATCAGGGCCGTGG + Intronic
1072625177 10:97106719-97106741 CAGCACAAAGATCATAGCCTTGG - Intronic
1076231571 10:128823769-128823791 CAGCAAGGGCAGCATGGCGTCGG + Intergenic
1076491299 10:130863303-130863325 CAGGACTGACCTCATGGACTTGG + Intergenic
1076507136 10:130985611-130985633 CAGCCCGTCCATCATGGGCTGGG - Intergenic
1076612276 10:131733786-131733808 CAGGACTGACAGCCTGGCCTGGG - Intergenic
1077047287 11:552176-552198 CAGCTCTGACTTCCTGGCCTTGG + Exonic
1077395171 11:2316955-2316977 AAGCACAGAGATCCTGGCCTGGG - Intronic
1082881293 11:58040914-58040936 CAGCAAAGACACCATGGCCATGG - Intronic
1083681070 11:64352125-64352147 CAGCACAGACTTCTCGGCCTAGG - Exonic
1084951325 11:72667476-72667498 CAGCAGGGCCCTCATGTCCTGGG + Intronic
1087905240 11:103688303-103688325 CAGCAAGGACAAGATGGCCTGGG + Intergenic
1094690337 12:32762230-32762252 CAGTCCCGACAACATGGCCTGGG - Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1099243942 12:80172359-80172381 CAGGAGGGACATCAAGGACTTGG - Intergenic
1101839694 12:108319138-108319160 CAGCAGAGACGTCATGGCCAGGG - Intronic
1103723795 12:122988103-122988125 CAGCTCCAACCTCATGGCCTGGG + Intronic
1104420396 12:128630105-128630127 GAGCAGGGACAGCATGGCCTTGG + Intronic
1107013193 13:35687837-35687859 CATCACGCAGATCATGGGCTGGG - Intergenic
1108682155 13:52789899-52789921 CATAACGGAAATAATGGCCTGGG - Intergenic
1110340546 13:74385070-74385092 CAGCACGGGGATCCTGGGCTCGG + Intergenic
1113827090 13:113264209-113264231 CAGGGCGGACACCATGGCCTTGG - Intronic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1122416009 14:101549791-101549813 CACCATGGACATCCTGGCCCTGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130335172 15:82952317-82952339 CAGCAGGGGCACCCTGGCCTGGG - Intronic
1132567145 16:628752-628774 CTGCACGGTCACCATCGCCTGGG + Exonic
1133125344 16:3642559-3642581 CAGCACCGAGAGCAGGGCCTGGG - Intronic
1136153592 16:28367878-28367900 CAGCCCGGACCGCATGGACTCGG + Intergenic
1136209495 16:28747389-28747411 CAGCCCGGACCGCATGGACTCGG - Intergenic
1138536189 16:57661640-57661662 CAGCACGGGCAGCATTTCCTGGG - Intronic
1139946671 16:70646861-70646883 AAGCACGGCCTACATGGCCTCGG - Exonic
1141215508 16:82019765-82019787 CAGCATGGACCACAGGGCCTTGG + Intergenic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1146574263 17:33977981-33978003 CAGCACTGAAACCATGGCCCGGG - Intronic
1149627549 17:58090487-58090509 CAGCATGGTCATCCTGTCCTGGG - Exonic
1152725222 17:81941775-81941797 CAGCAGGGACCCCAGGGCCTTGG - Exonic
1152822518 17:82444562-82444584 CATCACGGACATCATGGAGCAGG + Exonic
1155104093 18:22643381-22643403 CAGCACTGACATGATGGCTCTGG - Intergenic
1159923018 18:74243284-74243306 CAGGACAGAAATAATGGCCTGGG + Intergenic
1160891983 19:1383916-1383938 CAGCACCGCCATCTTGGCCTCGG - Exonic
1161507524 19:4651937-4651959 CAGCACGGCCACCACTGCCTTGG - Exonic
1164779139 19:30878646-30878668 AAGCACAGACCTCAGGGCCTGGG + Intergenic
1164835667 19:31353647-31353669 CAGCACTGCCTTCATGGCCCTGG - Intergenic
1166795656 19:45423880-45423902 CAGCACGGCCAGCGTGGCCCAGG + Intronic
925032174 2:659432-659454 CAGCAGGGTCATCATAGCTTTGG - Intergenic
930350076 2:50240586-50240608 CAGTAAGTACATCATGTCCTTGG - Intronic
934545478 2:95211489-95211511 AAGGACAGACAACATGGCCTTGG - Intronic
934784133 2:96992404-96992426 CACCAGGGACAGCAGGGCCTGGG - Intronic
941758209 2:169211668-169211690 CAGCACCGTCAGCATGCCCTGGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943345299 2:186731767-186731789 CATCACTCACATTATGGCCTGGG + Intronic
947663478 2:231887746-231887768 CAGCACGGCCTTCAATGCCTTGG - Intergenic
949049605 2:241890521-241890543 CACCACTGAAATCATGGACTAGG + Intergenic
1172874939 20:38158447-38158469 CAGCCCGGCCACCATGGTCTGGG - Intronic
1174417432 20:50376861-50376883 CTGCTGGGACACCATGGCCTGGG - Intergenic
1175440811 20:58989895-58989917 CAGCACGGACATCATGGCCTGGG - Exonic
1176076222 20:63249540-63249562 CAGCAAGGACAGTATGGCCAGGG + Intronic
1176137810 20:63532550-63532572 CATCACGGAGCTCATGGCCAAGG - Exonic
1176288683 21:5033123-5033145 CAGCAGTGGCATCATGGCCGTGG - Intronic
1179868501 21:44230352-44230374 CAGCAGTGGCATCATGGCCGTGG + Intronic
1182350742 22:29698032-29698054 CCTCACGGACATCATGAGCTGGG - Exonic
1184452475 22:44591296-44591318 CAGCCCGGACTTCTAGGCCTGGG + Intergenic
950520436 3:13494839-13494861 CAGCAGGGGCCTCATGGCTTAGG - Intronic
952237245 3:31492772-31492794 CAGCACAGACATCCTGAACTTGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953403979 3:42651392-42651414 CAGCATAAACATCATGGCTTTGG - Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
969589668 4:8114647-8114669 CACCACGGCCATCACTGCCTGGG + Intronic
974849808 4:67390932-67390954 GAGCACGGACATTATGCCCAAGG - Intergenic
978852587 4:113356148-113356170 CAGCACTGCCATCAGGGTCTCGG - Exonic
979173056 4:117626037-117626059 CAGCATGGAGATCATGGTCCTGG - Intergenic
986346885 5:6844046-6844068 CAGCATGGACAGGATGGCCGAGG - Intergenic
986827083 5:11533479-11533501 CAGCAAGGACCCCATAGCCTTGG + Intronic
990532000 5:56683407-56683429 CAGCACTGACATATTGGTCTGGG + Intergenic
990800775 5:59600071-59600093 CAGCACCCCCATCAAGGCCTTGG + Intronic
997338803 5:133126580-133126602 CAGAAGGGACATCATGGGCAAGG + Intergenic
997370820 5:133358513-133358535 CAGCACGGGCTTCAGGGCCTGGG - Intronic
997579544 5:135008669-135008691 CAGCACATACGTGATGGCCTGGG - Intronic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
999132960 5:149298717-149298739 CATCAGTGACATCATGGTCTTGG + Intronic
1003597063 6:7482870-7482892 CAGCCTGGCCAACATGGCCTTGG + Intergenic
1005906228 6:30263192-30263214 CAGCAAGGGCTTCATGGGCTGGG + Intergenic
1007597639 6:43061325-43061347 CAGGCCTGACATCCTGGCCTGGG - Exonic
1013983851 6:116166019-116166041 CCGCACTGACAGCATTGCCTGGG + Intronic
1014749148 6:125235541-125235563 CAGCACTCACACCATAGCCTAGG - Intronic
1022437383 7:30402460-30402482 CAGCAAGGAAAAAATGGCCTTGG - Intronic
1022762038 7:33365558-33365580 CACCAGGGAAATCATGGCCAAGG + Intronic
1023866405 7:44240485-44240507 CAGCACGAAGGTGATGGCCTCGG + Intronic
1024223125 7:47303524-47303546 CAGCAGGGAAACCATGGGCTTGG + Exonic
1025196996 7:56941242-56941264 CAGCATACTCATCATGGCCTGGG - Intergenic
1025253207 7:57365675-57365697 CTGCTGGGACACCATGGCCTGGG + Intergenic
1025674952 7:63635695-63635717 CAGCATACTCATCATGGCCTGGG + Intergenic
1027229478 7:76263904-76263926 AAGCAGGGACATCATGCCCTTGG + Intronic
1030176570 7:106660677-106660699 CAGCACGGAGTTCATGAGCTCGG - Exonic
1034682264 7:152938092-152938114 CAGCTCCCACATGATGGCCTGGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1050256496 9:3797465-3797487 CAGCAGTGTCAGCATGGCCTGGG + Intergenic
1056738199 9:89227499-89227521 CAACAGGGACCTGATGGCCTTGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1062483257 9:136762198-136762220 CAGCATGACCATCATGTCCTTGG + Exonic
1062624203 9:137435608-137435630 CAGCACGGCCAGCAGGGCCGGGG - Intronic
1062631255 9:137464147-137464169 CACCACCGACATCACAGCCTCGG - Exonic
1062631327 9:137464439-137464461 CATCAAGGACGTCATGCCCTGGG + Exonic
1186109208 X:6238046-6238068 TAGCACAGACATCTGGGCCTAGG + Intergenic
1186603572 X:11065099-11065121 GAGCACTGACATCATTGCGTGGG - Intergenic
1187779865 X:22807986-22808008 CAGCTCAGCCATCATGTCCTTGG - Intergenic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1192436303 X:71145589-71145611 CAGGATGGAGATCTTGGCCTTGG + Intronic
1197717507 X:129720061-129720083 CAGCACCCCCATCATGGCCAAGG + Intergenic