ID: 1175444512

View in Genome Browser
Species Human (GRCh38)
Location 20:59010752-59010774
Sequence CAGTGGTGCTTGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175444504_1175444512 6 Left 1175444504 20:59010723-59010745 CCTGGAGGTAATGGAGTCATTCC No data
Right 1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG No data
1175444503_1175444512 10 Left 1175444503 20:59010719-59010741 CCTTCCTGGAGGTAATGGAGTCA No data
Right 1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG No data
1175444498_1175444512 25 Left 1175444498 20:59010704-59010726 CCTATCCTGGGTTTTCCTTCCTG No data
Right 1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG No data
1175444501_1175444512 20 Left 1175444501 20:59010709-59010731 CCTGGGTTTTCCTTCCTGGAGGT No data
Right 1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175444512 Original CRISPR CAGTGGTGCTTGAGGGCAGA GGG Intergenic
No off target data available for this crispr