ID: 1175445547

View in Genome Browser
Species Human (GRCh38)
Location 20:59017295-59017317
Sequence GGATCCAGCCCAGGATCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175445534_1175445547 17 Left 1175445534 20:59017255-59017277 CCTCATACCATCCTCTATAGCAG No data
Right 1175445547 20:59017295-59017317 GGATCCAGCCCAGGATCATGGGG No data
1175445536_1175445547 6 Left 1175445536 20:59017266-59017288 CCTCTATAGCAGCCCTCTTCCCT No data
Right 1175445547 20:59017295-59017317 GGATCCAGCCCAGGATCATGGGG No data
1175445535_1175445547 10 Left 1175445535 20:59017262-59017284 CCATCCTCTATAGCAGCCCTCTT No data
Right 1175445547 20:59017295-59017317 GGATCCAGCCCAGGATCATGGGG No data
1175445539_1175445547 -6 Left 1175445539 20:59017278-59017300 CCCTCTTCCCTGGTCCTGGATCC No data
Right 1175445547 20:59017295-59017317 GGATCCAGCCCAGGATCATGGGG No data
1175445540_1175445547 -7 Left 1175445540 20:59017279-59017301 CCTCTTCCCTGGTCCTGGATCCA No data
Right 1175445547 20:59017295-59017317 GGATCCAGCCCAGGATCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175445547 Original CRISPR GGATCCAGCCCAGGATCATG GGG Intergenic
No off target data available for this crispr