ID: 1175446580

View in Genome Browser
Species Human (GRCh38)
Location 20:59024275-59024297
Sequence GGTGAGCTCGGCCACGGAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175446580_1175446586 8 Left 1175446580 20:59024275-59024297 CCCTCTCCGTGGCCGAGCTCACC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1175446586 20:59024306-59024328 GTTCGATGCCCGCAATACCATGG 0: 1
1: 0
2: 0
3: 2
4: 8
1175446580_1175446590 30 Left 1175446580 20:59024275-59024297 CCCTCTCCGTGGCCGAGCTCACC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175446580 Original CRISPR GGTGAGCTCGGCCACGGAGA GGG (reversed) Exonic
900083106 1:873862-873884 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
902378120 1:16039768-16039790 GGTGAGCTGGGAGACGGGGATGG - Intergenic
902383209 1:16062264-16062286 GGTGAGCTGGGAGACGGGGATGG - Intronic
908514642 1:64880113-64880135 GGTGTGCTGGGCCAGGGAGGGGG - Intronic
909594203 1:77386832-77386854 GGTGAGCGCAGGCAGGGAGAGGG - Intronic
920080135 1:203367115-203367137 GGAGAGCTAGGCCCCTGAGAAGG - Intergenic
920915727 1:210256500-210256522 GGGGGGATCAGCCACGGAGAGGG - Intergenic
923171512 1:231421680-231421702 GGCGCCCTCGGCCACGGAGTGGG - Exonic
1062857571 10:786916-786938 GGTGGACTCGGCCGCGGACAAGG - Intergenic
1063580684 10:7304031-7304053 GGCGAGGTGGGCCACGGAGATGG + Intronic
1064134221 10:12736732-12736754 GGCGAGAGCGGCCAGGGAGATGG - Intronic
1070250340 10:74767592-74767614 AGTGAGCTTGGCCAGGGAGCAGG + Intergenic
1072654359 10:97319833-97319855 GGCGAGCTCGGCCACGCAGTAGG - Exonic
1073116309 10:101093746-101093768 TGTGAGCTGGGCCCCGGGGAGGG + Intronic
1075664505 10:124221070-124221092 GGAGAGCCCAGCCAAGGAGAGGG + Intergenic
1076271179 10:129153379-129153401 GGTGAGCTCTGCAAAGGAGGAGG + Intergenic
1076897487 10:133320033-133320055 GGTGAGCTCTGCCCCAGGGACGG - Intronic
1077535536 11:3122326-3122348 GGTGAGCCCGGGCCCGGGGAGGG - Exonic
1080971117 11:37278548-37278570 GGTGGGCTCAGCCACGGACATGG - Intergenic
1081751044 11:45511588-45511610 GGCGAGCTGGTCCACTGAGAGGG - Intergenic
1084590887 11:70089576-70089598 TGTGAGTTCGGCCACCCAGATGG + Intronic
1089961081 11:122617802-122617824 GGAGAGGTCGGCCAGGGCGAAGG - Intergenic
1092261226 12:6954204-6954226 GGTGCGCTCCGCCAGGGAGGCGG - Intronic
1094813790 12:34165232-34165254 GGTAAGCTCAGCCACGGGCAGGG + Intergenic
1098163379 12:67669302-67669324 AGTGAGCCAGGCCAAGGAGAGGG - Intergenic
1104908311 12:132227351-132227373 GGGGAGCTGGGCCGGGGAGAGGG - Intronic
1106134287 13:26962479-26962501 GGTGGGGACGGCCACAGAGATGG + Intergenic
1109448942 13:62483442-62483464 AGTGAACTCGGCCAGGGAGTTGG - Intergenic
1113793572 13:113043482-113043504 GATGTGCCAGGCCACGGAGATGG - Intronic
1120614725 14:86689038-86689060 CGTGAGCTCTGCCACGGGGCAGG + Intergenic
1202926218 14_KI270724v1_random:28416-28438 GGTCAGCTCGGGCTCGGGGAGGG + Intergenic
1125602464 15:40923161-40923183 GGTGAGCACGGCCAGGGTGGAGG + Intergenic
1127854483 15:62943241-62943263 GGTGAGCCAGGCCAAAGAGAGGG + Intergenic
1130517135 15:84634051-84634073 GGCGCCCTCGGCCACGGAGGGGG + Intergenic
1131720512 15:95163398-95163420 GGTGAGGTGGGGCACGGTGACGG + Intergenic
1133136695 16:3717369-3717391 GGCGGGCCGGGCCACGGAGACGG - Intronic
1142414756 16:89935299-89935321 GGTGAGCTCGGGCACGGTCAGGG - Exonic
1142440697 16:90095705-90095727 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
1143139475 17:4733178-4733200 GGAGAACTAGGCCAGGGAGATGG + Exonic
1144179592 17:12739520-12739542 AGTCACCTCTGCCACGGAGAAGG + Intronic
1144871738 17:18376331-18376353 CCTGAACTCGGCCATGGAGAGGG - Intergenic
1152956858 18:47855-47877 GGTGAGCTCAGCCACAGTCAAGG + Exonic
1153972780 18:10241565-10241587 GGTGTGCTCTGCCAGGGAGCCGG - Intergenic
1154204505 18:12325637-12325659 GGTGAGCTCGGGCACGGTCAGGG - Exonic
1160497134 18:79382276-79382298 GGAGAGCTCGGGCGAGGAGAAGG + Intergenic
1160876957 19:1300828-1300850 GGTCTTCTCGGCCTCGGAGAGGG - Intergenic
1161678337 19:5665996-5666018 GGAGAGCTCTGCCAGGGTGAAGG - Intronic
1161815207 19:6495629-6495651 GGTGAGCTCGGGCACCGTCAGGG + Exonic
1165863483 19:38921682-38921704 GGTGGGCTCAGCCCGGGAGAGGG + Intronic
1166183124 19:41122682-41122704 GGAGAGCTGGGGAACGGAGAAGG - Intronic
1167608904 19:50496781-50496803 TGTGGGCTGGGCCACGGAGGAGG - Intergenic
1168291249 19:55358777-55358799 GGTGAGCGCTTCCACAGAGAAGG + Exonic
926139946 2:10362537-10362559 GGTGAGCTGGGCGATGGGGAAGG + Intronic
927494472 2:23543341-23543363 GGCGACCTCTGCCACAGAGATGG + Intronic
927929092 2:27032856-27032878 GGAGAGCCCGGCCCAGGAGAGGG + Intergenic
1168814742 20:728716-728738 GGTGAGGTTGGCCACTCAGAGGG - Intergenic
1171277409 20:23869802-23869824 GGAGAGCTCTGCAACGGGGATGG - Intergenic
1171389146 20:24790046-24790068 GCTGAGCTTGGCAAGGGAGAGGG + Intergenic
1171982088 20:31635387-31635409 GGTGGGCTGGACCACCGAGAAGG - Intergenic
1172657327 20:36545068-36545090 GGTGAGCTGGGACAGGGACAGGG + Exonic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175935839 20:62513653-62513675 GGTGGGCACGGCCCCGCAGAGGG + Intergenic
1182299968 22:29331807-29331829 GGTGGGCTCGGTCATGAAGATGG - Exonic
1183395036 22:37566705-37566727 GTTGAGCTGGGGCAGGGAGATGG - Exonic
1183404118 22:37621741-37621763 ATTGAGCTGGGCCACTGAGATGG + Intronic
952993744 3:38856312-38856334 GGTGAGTGCGGCCCCAGAGAAGG + Intronic
953801371 3:46026354-46026376 GTTGAGGTGGGCCACAGAGATGG - Intronic
956024056 3:64963195-64963217 GGTGAGATCACCCACAGAGAAGG - Intergenic
960955171 3:123026649-123026671 GGGGCGCTCGGGCACAGAGAGGG - Intronic
964685156 3:159387145-159387167 GGAGAGCTTGGCCAGGGTGATGG + Intronic
968357454 3:198120292-198120314 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
968564699 4:1305294-1305316 GGTGAGCCCGGCCCTGGTGAGGG + Intronic
973641283 4:52905359-52905381 GGAGGGTTCAGCCACGGAGAAGG + Intronic
979340133 4:119512920-119512942 GGTGAGATCATCCAGGGAGATGG + Intronic
985441086 4:189982958-189982980 GGTGAGCTCAGCCACAGTCAAGG + Intergenic
986287118 5:6367509-6367531 GATGAGCTTGTCCAGGGAGAGGG + Intergenic
990556547 5:56942198-56942220 GATGAGCTCACCCACGGAGAGGG + Intronic
997956092 5:138279704-138279726 GGTGACCTCTGCCATAGAGAAGG - Intergenic
1002405064 5:179024033-179024055 GGTGAACCCGGCCCCGGAGGGGG + Intronic
1003087038 6:3068634-3068656 GGACGGCGCGGCCACGGAGAAGG + Exonic
1005474579 6:26195734-26195756 CTTGAGCGCGGCCACAGAGAAGG - Intergenic
1006141860 6:31934059-31934081 GGTGGGCTCAGCCACTGAAAGGG + Intronic
1008124223 6:47650522-47650544 GGTGAGCTCCTCCAGGGAAAGGG + Intergenic
1011628523 6:89302611-89302633 GGTGAGCTCGGGCACGGTCAGGG - Intronic
1014097682 6:117478521-117478543 GCTGAGCTCTGCCACAGGGAGGG + Intronic
1016510361 6:144835938-144835960 GGTGTGCTAGGCCTGGGAGAAGG + Exonic
1018396166 6:163379606-163379628 GGGAAGCTGGGCCACAGAGAGGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019070604 6:169341851-169341873 GGTGAGTGTGGCCAGGGAGAGGG - Intergenic
1019637234 7:2082377-2082399 GGGGAGCTCAGCAAGGGAGATGG + Intronic
1019728741 7:2617864-2617886 GGTGAGAACGGGCAGGGAGACGG - Intergenic
1021945216 7:25719770-25719792 GGTGAGGTCGGCCAGAGAGCAGG + Intergenic
1022156061 7:27662869-27662891 GGCTGGCTCGCCCACGGAGAAGG + Exonic
1023683181 7:42709434-42709456 GGCTAGCTCGGCCACGGATCAGG + Intergenic
1023818978 7:43969868-43969890 GGTCAGCTCAGCCAGGGACACGG + Intergenic
1029268025 7:99357910-99357932 GGTGAGCACAGGCAAGGAGAAGG + Intronic
1029575415 7:101400282-101400304 GGTGGGCTCGGTCATGGAGTGGG + Intronic
1030862510 7:114653390-114653412 GCTGAACTCTGCCACGGAGTCGG - Intronic
1031899485 7:127393000-127393022 GGCGTGCGCGCCCACGGAGACGG + Intronic
1032550617 7:132780903-132780925 GCAGAGCTCGCCCAGGGAGATGG + Intergenic
1032750909 7:134840426-134840448 GGAGAGTTCAGCCACGGAGAAGG - Intronic
1034895862 7:154875948-154875970 GGTGAGCTGGGAGACGGTGATGG + Exonic
1034956975 7:155340891-155340913 GGAGTGCTCAGCCACGGGGAGGG - Intergenic
1036619560 8:10415644-10415666 GGTGGGCTAGGCCAGGGTGAGGG - Intronic
1037835668 8:22213537-22213559 CATGAGCTCTGCCACGGAGTTGG + Intergenic
1039311580 8:36322417-36322439 GGCCAGGGCGGCCACGGAGAAGG - Intergenic
1039452940 8:37690270-37690292 GGGGAGCTAGGCCGGGGAGATGG - Intergenic
1040392165 8:46959603-46959625 AGTGAGTTTGGCCAGGGAGAAGG + Intergenic
1041201059 8:55452300-55452322 GGTCAGCGCGGCCACCGGGAAGG + Intronic
1041552866 8:59119854-59119876 GGTGGGGACGGCCGCGGAGAGGG - Intergenic
1047737652 8:127780704-127780726 AGGGAGCTCTGCCACTGAGATGG - Intergenic
1049410235 8:142470755-142470777 GCTGTGACCGGCCACGGAGATGG + Intronic
1056269207 9:84930312-84930334 TCTGAGCTCGGCCCCTGAGAAGG + Intronic
1058885043 9:109316571-109316593 GCTGAGCTAGGCTAAGGAGAGGG + Intronic
1060480654 9:124015158-124015180 GGGCATCTCGGCCTCGGAGATGG + Exonic
1061287229 9:129631010-129631032 GGTGAGCTCGGAAAGGCAGACGG - Intronic
1062230873 9:135480553-135480575 GGTGAGCGCGCCCTCGGGGAGGG + Intronic
1062535012 9:137017597-137017619 GGTGAGTGCTGTCACGGAGATGG + Exonic
1062741304 9:138176777-138176799 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
1186057261 X:5663125-5663147 GGTGACATCAGCCAAGGAGATGG - Intergenic
1187281602 X:17861444-17861466 GGTGATCTCGCCCACGGGGAGGG + Intergenic
1189284395 X:39841096-39841118 GGGCAGCCCAGCCACGGAGAGGG - Intergenic
1195706758 X:107742976-107742998 GGTGAGGCCGCCCAGGGAGAGGG + Intronic
1195766130 X:108298456-108298478 GGTGAGGCCGCCCAGGGAGAGGG - Intronic
1198275431 X:135094532-135094554 GGTGACCTCAGGCAGGGAGAAGG + Intergenic
1199679390 X:150214876-150214898 GGCGAGCTCGGCGGCGGGGAGGG + Intergenic
1199695837 X:150342173-150342195 GGCGAGCTCGGCGGCGGGGAGGG - Intergenic