ID: 1175446590

View in Genome Browser
Species Human (GRCh38)
Location 20:59024328-59024350
Sequence GCTGCCTGTGACCTCCGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175446588_1175446590 -10 Left 1175446588 20:59024315-59024337 CCGCAATACCATGGCTGCCTGTG 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152
1175446581_1175446590 29 Left 1175446581 20:59024276-59024298 CCTCTCCGTGGCCGAGCTCACCC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152
1175446580_1175446590 30 Left 1175446580 20:59024275-59024297 CCCTCTCCGTGGCCGAGCTCACC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152
1175446587_1175446590 -9 Left 1175446587 20:59024314-59024336 CCCGCAATACCATGGCTGCCTGT 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152
1175446585_1175446590 8 Left 1175446585 20:59024297-59024319 CCAGCAGATGTTCGATGCCCGCA 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152
1175446583_1175446590 18 Left 1175446583 20:59024287-59024309 CCGAGCTCACCCAGCAGATGTTC 0: 6
1: 1
2: 1
3: 18
4: 205
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152
1175446582_1175446590 24 Left 1175446582 20:59024281-59024303 CCGTGGCCGAGCTCACCCAGCAG 0: 1
1: 3
2: 6
3: 28
4: 241
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152
1175446584_1175446590 9 Left 1175446584 20:59024296-59024318 CCCAGCAGATGTTCGATGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG 0: 1
1: 0
2: 3
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175446590 Original CRISPR GCTGCCTGTGACCTCCGCCG TGG Exonic
900083110 1:873915-873937 GCTGCCCGTGACCCCCGTCACGG + Intergenic
900195147 1:1372141-1372163 GATGCCTGTGACCCCAGCTGGGG + Intergenic
900199423 1:1397220-1397242 GCTGCCTCTGACCTTAGCCCAGG - Intronic
900353083 1:2246500-2246522 GCTGCCTCTGTCCTCTGCTGTGG + Intronic
900967289 1:5967484-5967506 GCTGCCTCTGCCTTCCGCAGAGG - Intronic
901142437 1:7043899-7043921 GATGCATGTGATCTCCGCAGGGG + Intronic
901628885 1:10638764-10638786 GCCGCCTGTGTCCTCGGCCGCGG + Exonic
903229529 1:21913443-21913465 GCTGCCTGTCACCTTCGACCAGG + Intronic
904170254 1:28586768-28586790 GCTCACTGCAACCTCCGCCGAGG - Intergenic
907307109 1:53519631-53519653 GCGGCCTGAGACCTGCCCCGTGG + Intronic
908953312 1:69589228-69589250 GCTGTCTCTGACCTCTGCTGAGG + Intronic
915199584 1:154217020-154217042 GCTCACTGCAACCTCCGCCGGGG + Intronic
917869632 1:179229737-179229759 CCCGCCAGTCACCTCCGCCGCGG + Intergenic
920777190 1:208951282-208951304 GCTCCCTGTGTCCTGCTCCGAGG - Intergenic
924150946 1:241128510-241128532 GCTCACTGTAACCTCCGCCCCGG - Intronic
1062763947 10:47469-47491 GCTGCCTGTGACCCCCGTCACGG - Exonic
1062905681 10:1178159-1178181 GGTGCCTGAGACCTCCTCCTGGG + Exonic
1064029986 10:11877515-11877537 GGTGCCTGTGACCTCGGCCTTGG + Intergenic
1065529384 10:26653197-26653219 GCTGCCTGTGCCCTTGGCCTTGG - Intergenic
1065590749 10:27259056-27259078 GCTGCAGGTGACTTCGGCCGGGG + Intergenic
1067755661 10:49002471-49002493 GCTGCCTGGGGCCTCTGGCGGGG - Intergenic
1067847931 10:49737911-49737933 CCTGCCTGTGACCCCTGCCCTGG + Intronic
1068474962 10:57513301-57513323 GCTGCCTCCGACCCCCGCCTTGG + Intergenic
1070536707 10:77384100-77384122 GATGCCAGTGATCTCCGCGGGGG - Intronic
1076637972 10:131895145-131895167 GCTGCTAGTGTCCTCCGCTGTGG + Intergenic
1077150991 11:1073128-1073150 GCTGCCTGTAACCTCAGACAGGG + Intergenic
1077186251 11:1236686-1236708 CCTGCCTGTGGCCTCCACAGTGG + Intronic
1077372573 11:2190296-2190318 GCTGCCTGTGCCCTCCTCATGGG + Intergenic
1083278604 11:61611530-61611552 GCTGCCTGTGACATCTCCCTAGG + Intergenic
1083624896 11:64067429-64067451 GCTGGCTGTCACCTGGGCCGGGG - Intronic
1084302566 11:68261132-68261154 GCTGGCTGTGGCCTCCTCTGGGG + Intergenic
1085025517 11:73234264-73234286 GCTGCCTGTGTCCTACGGCGTGG + Exonic
1085729331 11:78982980-78983002 GCTCCCTGTGACCTTTCCCGAGG + Intronic
1095103140 12:38203347-38203369 GCCGCCTGTGACCCCCGCCATGG + Intergenic
1103096411 12:118136281-118136303 GCTGCATGTCACCTACGCCGGGG + Exonic
1103429960 12:120875106-120875128 GATGCCTGTGTCCTCTGCTGAGG - Intronic
1103615228 12:122147609-122147631 TCTGCCTGTGGCCTCAGCAGGGG + Intergenic
1104751875 12:131245196-131245218 GCTGCCTGTGCCCTGCTCAGAGG + Intergenic
1104780019 12:131413879-131413901 GCTGCCTGTGCCCTGCTCAGAGG - Intergenic
1104906342 12:132215454-132215476 GCTGCTTGTGCTCTCCGTCGAGG - Intronic
1104961494 12:132490357-132490379 GCGGCCTGGGACCCCCGGCGCGG - Exonic
1105211462 13:18259465-18259487 GTTGCCTGTGGCCTCCTCCCAGG - Intergenic
1106452151 13:29892344-29892366 GCTGCCTGTGACCGTGGCCTCGG + Intergenic
1107540540 13:41385122-41385144 GCTGCCTGTGACCCCCGCCACGG - Intergenic
1107851291 13:44576044-44576066 GCCGCCTGAGTCCACCGCCGCGG - Exonic
1122112896 14:99514355-99514377 GTTGGCTGTGACCTCCCCCAGGG - Exonic
1124627802 15:31319008-31319030 GCTGCCTGTCACCTCTGCACTGG - Intergenic
1127644841 15:60947787-60947809 GCTGCCTGCAGCCTCCGCAGTGG + Intronic
1128743350 15:70097642-70097664 CCTGCCTGTGCGCTCCGACGCGG - Exonic
1130409733 15:83635265-83635287 GCTGCCTGTGACCTTTTCCCTGG - Intergenic
1130995243 15:88899776-88899798 GATGCCTGTCACCTCCTTCGAGG + Exonic
1132677105 16:1125351-1125373 GCTGCCTGTCCCCTCTGCCTGGG - Intergenic
1132973358 16:2699750-2699772 GCTGCCTGTGGCCCCAGCCCAGG - Intronic
1134251473 16:12577217-12577239 GCTCCTGGTGACCTCTGCCGTGG + Intergenic
1135163498 16:20117851-20117873 GCTGCCTGGGAGCTCAGCAGGGG + Intergenic
1141496656 16:84414935-84414957 GCTGACTCTGACCTCCGACCTGG - Intronic
1141765344 16:86054616-86054638 GCTGACTGTGACCACTGCCAAGG - Intergenic
1141828686 16:86497782-86497804 GCAGCCTGGGACCTCCGGCCTGG + Intergenic
1142076383 16:88120459-88120481 GCTGCCTGTGTTCTCCGAGGTGG - Intergenic
1142136742 16:88454942-88454964 CATGCCTGTGACCCCCGCCTCGG - Intronic
1142221622 16:88857599-88857621 TCTGCCTGAGACCTCTGCAGTGG + Intronic
1142289033 16:89184306-89184328 GCTGGCTGTGACTTCCCCCCGGG - Intronic
1142440701 16:90095758-90095780 GCTGCCTGTGACCCCCGTCATGG + Intergenic
1142592826 17:1013846-1013868 GTTGCCTCTGACCTCCCCTGGGG - Intronic
1142968171 17:3593777-3593799 GCACCCTGTGACCTCCTCCTGGG + Intronic
1143419684 17:6779025-6779047 GCTCTCTGTGACCTCAGCTGGGG + Intronic
1144944269 17:18961753-18961775 GCTGCATGAGACCCCCACCGGGG - Intronic
1146474907 17:33154989-33155011 GCTGTCTTTCACCTGCGCCGCGG + Intronic
1148233055 17:45949262-45949284 GCAGCCTGAGACACCCGCCGGGG + Intronic
1148430272 17:47637372-47637394 GCTCACTGTGACCTCCGCCTCGG + Intergenic
1149614869 17:57988644-57988666 GTGGCCTGTGCCCTCCGCTGAGG - Intergenic
1149622304 17:58054977-58054999 GCTGCCTGTGACCGGAGCCTTGG + Intergenic
1150289337 17:63972608-63972630 GATGCCGATGACCTCCGGCGGGG + Exonic
1150658190 17:67054223-67054245 GCTGCCTGGGGCCTCCGGAGCGG - Intronic
1152248599 17:79199530-79199552 GCTGCCAGTGACCTCTGTGGTGG + Intronic
1152938931 17:83155508-83155530 CCTGCCTGTGCCCTCCGGCGGGG + Intergenic
1152956854 18:47802-47824 GCTGCCTGTGACCCCCGTCACGG - Exonic
1153207910 18:2723422-2723444 GTTGCCTGTGAGCTCCACTGTGG + Intronic
1153789080 18:8561486-8561508 GCTGCCAGAGACCTCCGGAGTGG + Intergenic
1156361809 18:36390231-36390253 GCTGCCTGTCACCTGCCCAGTGG - Intronic
1161408359 19:4102766-4102788 GCTGCCTGAGCCCCCGGCCGCGG - Intronic
1161458525 19:4382215-4382237 GCTCCCTGTGACCACAGCAGGGG + Intronic
1161670377 19:5604527-5604549 GCTGCCCGTGCCCTCCTCCCAGG + Intronic
1163617738 19:18339942-18339964 CCTGGCTGTCACCTCCTCCGAGG - Intergenic
1163665865 19:18603919-18603941 GCTGCCTGGGACCTCCAGGGCGG - Intronic
1163713551 19:18861118-18861140 GCTGTCTGTGCCCTCCCCAGAGG - Intronic
1165541802 19:36498077-36498099 GATGGCTGTGACCTGCACCGTGG - Intergenic
1165650312 19:37482348-37482370 GCTTCCTGAGACCTCCTCGGAGG - Intronic
1168071278 19:53953386-53953408 GCTGGCTGTGTCCTCTGCTGGGG + Intergenic
925915387 2:8600742-8600764 GCTGCCTGTCACCACGGCCATGG - Intergenic
929071781 2:38038511-38038533 GCTGCCTGCAACCCCCGCCTCGG + Intronic
931045083 2:58341827-58341849 GCTGTCTGTGACTTCCTCAGTGG - Intergenic
932650295 2:73548419-73548441 GCTGCCTCTCACCTCCTCTGAGG + Intronic
933713059 2:85341745-85341767 GCTGCATGTCACCTACGCCCGGG - Intergenic
934501245 2:94861797-94861819 GCAGCCTGGGAGCTCCTCCGAGG + Intergenic
935121393 2:100186323-100186345 GCTGCCTGTTACCTGCACAGTGG + Intergenic
937156725 2:119725031-119725053 GCTGCCAGGGACGTCCCCCGGGG - Intergenic
937333917 2:121049030-121049052 CCTGCCTGCTACCTCCCCCGTGG - Intergenic
937910469 2:127073241-127073263 GCTGGCTGGGGCCTCCGTCGGGG - Intronic
938910959 2:135885706-135885728 GCTCCCTGTGGGCTCCACCGAGG - Intergenic
943571526 2:189580829-189580851 GCTCCCTGCGACCTCCGACTGGG + Exonic
945068326 2:205966062-205966084 GGTGCCTGTGACCGCTGCTGTGG + Intergenic
947429191 2:230010769-230010791 CCAGCCTGTGTCCTCCGCCAGGG - Exonic
1169230417 20:3884819-3884841 ATTGCCTGTGAGCTCCGTCGAGG + Intergenic
1169541418 20:6604118-6604140 GCTGCATGTCACCTCCTCTGTGG - Intergenic
1172022391 20:31923941-31923963 GCAGCCTGTGACATCCGTCTTGG + Intronic
1173843106 20:46171951-46171973 TCTGCCTGTGACCTCCTTCTTGG + Intergenic
1175446590 20:59024328-59024350 GCTGCCTGTGACCTCCGCCGTGG + Exonic
1175896395 20:62337673-62337695 GCAGCCTGTGACCCCCGGAGTGG - Exonic
1175967443 20:62666542-62666564 GCTGGCTGTGACGCCCGCCATGG - Exonic
1176190733 20:63808417-63808439 CCTGTCCGTGACCTCCGCCCTGG - Intronic
1179496950 21:41778180-41778202 GCCGCCTGCGCCCCCCGCCGGGG + Intergenic
1180050062 21:45326994-45327016 GCAGCCTGTGAGCTGTGCCGGGG - Intergenic
1180844567 22:18974066-18974088 GGTGCCTGTGACCTTGGCCTGGG - Intergenic
1181056907 22:20264645-20264667 GGTGCCTGTGACCTTGGCCTGGG + Intronic
1183526257 22:38324781-38324803 GCTGCCTGTGACCTTGGACAAGG - Intronic
1184238521 22:43199565-43199587 GCTGCCTGAGGCCTCCACCGTGG + Exonic
949125991 3:445657-445679 GCTGCCTGAGGCCTCCCCTGAGG - Intergenic
949923075 3:9019480-9019502 GCTGCCTTTCACCTCCCCCATGG - Intronic
954219356 3:49143580-49143602 GCTGCCTGTGACCCCCACAGTGG - Intergenic
954415804 3:50392711-50392733 GCTGCCTGTGAGCTCAGCTATGG - Intronic
954418947 3:50408440-50408462 TCTGCCTGTCACCTCTGCCTGGG - Intronic
954693179 3:52406642-52406664 GCTGCCTGTGGCCTGCTCCTGGG - Intronic
961780010 3:129315857-129315879 CCTGCCAGTGACGACCGCCGAGG - Exonic
964762918 3:160151559-160151581 GCTGCCTGTGACTTCAACCCCGG + Intergenic
968357458 3:198120345-198120367 GCTGCCTGTGACCCCCGTCACGG + Intergenic
968757835 4:2426068-2426090 GGTGCCTGTGCTCTCTGCCGTGG + Intronic
976678593 4:87730530-87730552 GCTGCCTGTCACCTCTCCTGGGG - Intergenic
985441082 4:189982905-189982927 GCTGCCCGTGACCCCCGTCACGG - Intergenic
985573583 5:663532-663554 GCTGGCTGGGAGCTCCGCCCTGG + Exonic
985575085 5:670193-670215 GGGGCCTGTGACGTCCGCCCCGG - Intronic
986095813 5:4553301-4553323 GTTGCCTGTCACCTCAGCAGTGG + Intergenic
1000898785 5:166888787-166888809 ACTGGCTGTGCCCTCCGCCTGGG - Intergenic
1004492374 6:16129109-16129131 GCTGCCCCTGTCCTCCGCGGTGG - Exonic
1005965544 6:30723963-30723985 GCTGCCTGTGACCCCCGCCACGG + Exonic
1007189344 6:40000025-40000047 GCTGCCTGTGAACCCCGCCATGG + Intergenic
1007614545 6:43172250-43172272 GCAGCCTCTCACCTCCGCCTCGG - Intronic
1008662908 6:53687284-53687306 GCTGCCTTTGACTTCCCACGGGG + Intergenic
1010744603 6:79546763-79546785 GCTCACTGTAACCTCCGCCTGGG + Intergenic
1018294574 6:162331800-162331822 GCTGACTGAGACCTCCGTAGCGG + Intronic
1019326093 7:438931-438953 GCAGCCTGTGACCTCTGACCCGG - Intergenic
1025041114 7:55646518-55646540 GCTGCTTGTGACCCCCGCCACGG + Intergenic
1025478369 7:60955762-60955784 GCTGTTTGTCACCGCCGCCGTGG + Intergenic
1033221436 7:139528822-139528844 GCTTCCTCTGACCTCTGCAGGGG - Intronic
1034175891 7:149099530-149099552 GCTCACTGTGACCTCCGTCCTGG + Intergenic
1035560841 8:602503-602525 CCTGACTCTGACCTCCGACGGGG + Intergenic
1038757242 8:30352908-30352930 GCTGCCTGTGACCCCCGCCACGG + Intergenic
1042743302 8:72075524-72075546 GCTGCCTGTGAGCTGCAGCGCGG - Exonic
1042759090 8:72251680-72251702 GCTGCCTGTGAGCTGCAGCGAGG - Intergenic
1045312947 8:101019045-101019067 GCTGCCTGTCACCACAGCCATGG - Intergenic
1049229200 8:141473360-141473382 GCTGCCTTAGTCCTCAGCCGGGG + Intergenic
1049644163 8:143728593-143728615 GCCGCTTGTGCCCTCGGCCGCGG - Exonic
1051878116 9:21812031-21812053 GCTGCCTGCAACCTCTGCCATGG - Intronic
1057308325 9:93925325-93925347 GCTGCCTGAGAGCTCCTCTGAGG + Intergenic
1057447371 9:95126768-95126790 GCTGCCTGTAACCCCTGCCCAGG - Intronic
1060046801 9:120348030-120348052 GATGACTGTGACCTCGCCCGGGG - Intergenic
1060046957 9:120349052-120349074 GCTGCCTCTGACTTCCACAGGGG - Intergenic
1060926327 9:127457735-127457757 GCTGACTGTGAGCTCCTCCCCGG + Intronic
1061421314 9:130474289-130474311 GCTGCCTCTGACTTCCGCTGCGG + Intronic
1061937312 9:133864882-133864904 GCGGTCTGTGAGCTCCTCCGGGG + Intronic
1062584521 9:137243119-137243141 GCTGCCTGCGACCCCCGCCATGG + Exonic
1062592434 9:137280387-137280409 GTTGGCTGTGGCCTCCTCCGGGG - Exonic
1062741309 9:138176830-138176852 GCTGCCCGTGACCCCCGTCACGG + Intergenic
1187464923 X:19518627-19518649 GCTGCTTGTGATTTCCGCCAGGG - Intergenic
1187873529 X:23783746-23783768 GGTGCCTGTCACCTTCGCCAAGG + Intronic
1189320358 X:40083713-40083735 GCGCGCTGGGACCTCCGCCGAGG - Intronic
1196721654 X:118859946-118859968 GCTTCCTGAGACCTCCCCGGAGG + Intergenic
1196826442 X:119743968-119743990 GCTGGCTGGGACCTCAGCTGAGG - Intergenic
1196840230 X:119852854-119852876 GCTGCCTGTGGCCCCGGCGGGGG + Exonic
1198755919 X:139982515-139982537 GCTCACTGTGACCTCCTCCCGGG + Intergenic
1198913111 X:141635949-141635971 GCTGACTGCAACCTCCGCCTGGG + Intronic
1199543887 X:148986965-148986987 ACTGCCTTTGACCACCACCGAGG - Intronic
1199678805 X:150210497-150210519 GCTCCCTGTGATCTCAGCCTTGG - Intergenic