ID: 1175448127

View in Genome Browser
Species Human (GRCh38)
Location 20:59040473-59040495
Sequence GTAATCAATCCAAAGAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175448126_1175448127 18 Left 1175448126 20:59040432-59040454 CCACTGGCGCAGCATCGAGGTCT No data
Right 1175448127 20:59040473-59040495 GTAATCAATCCAAAGAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175448127 Original CRISPR GTAATCAATCCAAAGAACAG TGG Intronic