ID: 1175451461

View in Genome Browser
Species Human (GRCh38)
Location 20:59072344-59072366
Sequence CAATGGAGGCAGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175451450_1175451461 16 Left 1175451450 20:59072305-59072327 CCATGTGAAGACAGAGACACCGG No data
Right 1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG No data
1175451454_1175451461 -3 Left 1175451454 20:59072324-59072346 CCGGGAGAAGATGGCCATGACAA No data
Right 1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175451461 Original CRISPR CAATGGAGGCAGAGGCTGGA GGG Intergenic
No off target data available for this crispr