ID: 1175456119

View in Genome Browser
Species Human (GRCh38)
Location 20:59115816-59115838
Sequence ATCACAGCCCACCCTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175456119_1175456124 8 Left 1175456119 20:59115816-59115838 CCTGGAGTAGGGTGGGCTGTGAT No data
Right 1175456124 20:59115847-59115869 CTGGTGTCCATCCATGTACGGGG No data
1175456119_1175456130 29 Left 1175456119 20:59115816-59115838 CCTGGAGTAGGGTGGGCTGTGAT No data
Right 1175456130 20:59115868-59115890 GGGGAAATTTGGACCCAGTTAGG No data
1175456119_1175456123 7 Left 1175456119 20:59115816-59115838 CCTGGAGTAGGGTGGGCTGTGAT No data
Right 1175456123 20:59115846-59115868 ACTGGTGTCCATCCATGTACGGG No data
1175456119_1175456125 9 Left 1175456119 20:59115816-59115838 CCTGGAGTAGGGTGGGCTGTGAT No data
Right 1175456125 20:59115848-59115870 TGGTGTCCATCCATGTACGGGGG No data
1175456119_1175456128 18 Left 1175456119 20:59115816-59115838 CCTGGAGTAGGGTGGGCTGTGAT No data
Right 1175456128 20:59115857-59115879 TCCATGTACGGGGGGAAATTTGG No data
1175456119_1175456126 10 Left 1175456119 20:59115816-59115838 CCTGGAGTAGGGTGGGCTGTGAT No data
Right 1175456126 20:59115849-59115871 GGTGTCCATCCATGTACGGGGGG No data
1175456119_1175456122 6 Left 1175456119 20:59115816-59115838 CCTGGAGTAGGGTGGGCTGTGAT No data
Right 1175456122 20:59115845-59115867 GACTGGTGTCCATCCATGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175456119 Original CRISPR ATCACAGCCCACCCTACTCC AGG (reversed) Intergenic
No off target data available for this crispr