ID: 1175458074

View in Genome Browser
Species Human (GRCh38)
Location 20:59130172-59130194
Sequence TTGCTGTTATTAAAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175458071_1175458074 7 Left 1175458071 20:59130142-59130164 CCTGGCACTTGGTAAGAAGCTGA No data
Right 1175458074 20:59130172-59130194 TTGCTGTTATTAAAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175458074 Original CRISPR TTGCTGTTATTAAAGAGACA GGG Intergenic
No off target data available for this crispr