ID: 1175458437

View in Genome Browser
Species Human (GRCh38)
Location 20:59132855-59132877
Sequence GCTGAGGCTCCACTCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175458429_1175458437 16 Left 1175458429 20:59132816-59132838 CCTTGCTGGCCCGGGTGAGCTGT No data
Right 1175458437 20:59132855-59132877 GCTGAGGCTCCACTCTGCTGAGG No data
1175458428_1175458437 20 Left 1175458428 20:59132812-59132834 CCAGCCTTGCTGGCCCGGGTGAG No data
Right 1175458437 20:59132855-59132877 GCTGAGGCTCCACTCTGCTGAGG No data
1175458430_1175458437 7 Left 1175458430 20:59132825-59132847 CCCGGGTGAGCTGTGCCAAGAGC No data
Right 1175458437 20:59132855-59132877 GCTGAGGCTCCACTCTGCTGAGG No data
1175458431_1175458437 6 Left 1175458431 20:59132826-59132848 CCGGGTGAGCTGTGCCAAGAGCC No data
Right 1175458437 20:59132855-59132877 GCTGAGGCTCCACTCTGCTGAGG No data
1175458425_1175458437 28 Left 1175458425 20:59132804-59132826 CCGCTTCTCCAGCCTTGCTGGCC No data
Right 1175458437 20:59132855-59132877 GCTGAGGCTCCACTCTGCTGAGG No data
1175458435_1175458437 -8 Left 1175458435 20:59132840-59132862 CCAAGAGCCAGCTGGGCTGAGGC No data
Right 1175458437 20:59132855-59132877 GCTGAGGCTCCACTCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175458437 Original CRISPR GCTGAGGCTCCACTCTGCTG AGG Intergenic
No off target data available for this crispr