ID: 1175460149

View in Genome Browser
Species Human (GRCh38)
Location 20:59146316-59146338
Sequence CGCTCTCTCCCGAAAACCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175460149_1175460152 -2 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460152 20:59146337-59146359 CGGCAGCCCCCACCTGCCTGTGG 0: 1
1: 1
2: 0
3: 42
4: 336
1175460149_1175460159 14 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460159 20:59146353-59146375 CCTGTGGACTGAGCACTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1175460149_1175460160 23 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175460149 Original CRISPR CGCTCTCTCCCGAAAACCGG TGG (reversed) Intergenic