ID: 1175460149

View in Genome Browser
Species Human (GRCh38)
Location 20:59146316-59146338
Sequence CGCTCTCTCCCGAAAACCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175460149_1175460152 -2 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460152 20:59146337-59146359 CGGCAGCCCCCACCTGCCTGTGG 0: 1
1: 1
2: 0
3: 42
4: 336
1175460149_1175460160 23 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238
1175460149_1175460159 14 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460159 20:59146353-59146375 CCTGTGGACTGAGCACTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175460149 Original CRISPR CGCTCTCTCCCGAAAACCGG TGG (reversed) Intergenic
902601213 1:17540858-17540880 CCCTCTCTCCCCAGAACCCGAGG - Intronic
915171136 1:153977868-153977890 TGCTCTCTCCTTAAAACCCGAGG + Intergenic
915463992 1:156085300-156085322 CGCTCTCTCCCGGAGGCTGGTGG + Intronic
1076273219 10:129174676-129174698 CTCTCTCTCTCCAACACCGGGGG + Intergenic
1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG + Intronic
1105251687 13:18704421-18704443 GGATCTCTCCTGAAAACTGGTGG - Intergenic
1113742921 13:112723863-112723885 CTGTCTCGCCCGAAACCCGGAGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148450886 17:47777278-47777300 AACTCTCTCCCAAAAACCAGAGG - Intergenic
1153794265 18:8608854-8608876 CGCTCTCTCACAAACACCAGCGG - Intergenic
1160948359 19:1653809-1653831 CGCTTTCACCCGAAAGGCGGAGG + Intergenic
1161560356 19:4969430-4969452 CGCCCCCGCCCGAAAACCAGCGG - Intronic
927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG + Intergenic
929151335 2:38751541-38751563 CGATCTCTCCAGTAAACCTGAGG + Intronic
934775583 2:96935063-96935085 CGCTCTGTCACGCATACCGGGGG - Intronic
944663108 2:201937599-201937621 CGCTCCCTCCCTAACACTGGGGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175644314 20:60658228-60658250 CTCTCTATCCCGGAACCCGGAGG + Intergenic
1176837211 21:13804307-13804329 GGATCTCTCCTGAAAACTGGTGG - Intergenic
1002921418 6:1575851-1575873 AGTTCTCTCTCCAAAACCGGCGG + Intergenic
1006116843 6:31780146-31780168 CCCTCTCTCCCCAAGCCCGGAGG - Exonic
1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG + Exonic
1012475621 6:99613199-99613221 CGGTCTCTCCCCAAAACCCCCGG + Exonic
1018790359 6:167143516-167143538 CGCTTTCTCCTGAAGGCCGGAGG + Intergenic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1038035286 8:23682159-23682181 CTCTCTCTCCTGGACACCGGAGG + Intronic
1038191372 8:25324121-25324143 CACTCTCTCCAGAAAGCAGGTGG - Intronic
1047541281 8:125768781-125768803 CGCTCCCTCCCCAAACCCTGTGG - Intergenic
1047760281 8:127949474-127949496 AGCTCCCTCCCAAAAACAGGAGG - Intergenic
1199649386 X:149938389-149938411 CGCTTACTCCCGGAAACCGGTGG + Exonic