ID: 1175460152

View in Genome Browser
Species Human (GRCh38)
Location 20:59146337-59146359
Sequence CGGCAGCCCCCACCTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 1, 2: 0, 3: 42, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175460145_1175460152 13 Left 1175460145 20:59146301-59146323 CCTGCCTCATCGGAGCCACCGGT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1175460152 20:59146337-59146359 CGGCAGCCCCCACCTGCCTGTGG 0: 1
1: 1
2: 0
3: 42
4: 336
1175460146_1175460152 9 Left 1175460146 20:59146305-59146327 CCTCATCGGAGCCACCGGTTTTC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1175460152 20:59146337-59146359 CGGCAGCCCCCACCTGCCTGTGG 0: 1
1: 1
2: 0
3: 42
4: 336
1175460149_1175460152 -2 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460152 20:59146337-59146359 CGGCAGCCCCCACCTGCCTGTGG 0: 1
1: 1
2: 0
3: 42
4: 336
1175460151_1175460152 -5 Left 1175460151 20:59146319-59146341 CCGGTTTTCGGGAGAGAGCGGCA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1175460152 20:59146337-59146359 CGGCAGCCCCCACCTGCCTGTGG 0: 1
1: 1
2: 0
3: 42
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175460152 Original CRISPR CGGCAGCCCCCACCTGCCTG TGG Intergenic
900179309 1:1304336-1304358 CGGCTGCCTCTGCCTGCCTGGGG - Intronic
900213344 1:1468073-1468095 CTGCAGTTCCCACCTGCCTCTGG + Intronic
900361554 1:2291531-2291553 CTGCAGCCCCAACCTTGCTGGGG - Intronic
900433097 1:2612076-2612098 GGCCAGCGCCCACCTGCCTGGGG + Intronic
900488574 1:2935196-2935218 CAGCACCCTCCACCTGCCTGAGG + Intergenic
901238473 1:7679934-7679956 TGCCAGACCCCACCTGGCTGGGG + Intronic
901320714 1:8338365-8338387 CCCCTGCCCCCACCTCCCTGGGG - Intronic
901559314 1:10057650-10057672 CTGCAGCCTCAACCTCCCTGGGG - Intronic
901627301 1:10631497-10631519 CGGCTGCCTCCACCTGCTGGAGG + Intergenic
901684943 1:10938678-10938700 CCGGAGCCCCCAGCTGCTTGAGG - Intergenic
901793539 1:11667277-11667299 GGCCAACCCCCACCTACCTGGGG + Intronic
901811765 1:11771427-11771449 GGGCAGACCGCACCTGCCTGGGG + Intronic
902399287 1:16149178-16149200 ATGCAGCCCCCACCCGCCTCAGG - Intronic
902694821 1:18133222-18133244 CCCCAGCCCCAACCTTCCTGAGG + Intronic
902740452 1:18434258-18434280 CAGCACCACCCACCTGCTTGAGG + Intergenic
902822286 1:18950728-18950750 GGCCAGCACCCACCTGCTTGAGG + Intronic
902871389 1:19315611-19315633 AGACAGCCCCCACCTGGATGAGG + Intronic
902884309 1:19393721-19393743 CGGCAGACCCAAGGTGCCTGGGG + Intronic
904003474 1:27351189-27351211 CTGCAGACCCCACCCTCCTGAGG + Intronic
904308902 1:29612507-29612529 CAGCAGCTCACACCTGCCTTGGG - Intergenic
907305820 1:53512674-53512696 CGCCTGCCCACCCCTGCCTGCGG - Intronic
908966261 1:69767964-69767986 CTGCAGCCCTCACCTGGATGTGG - Intronic
912893164 1:113557314-113557336 TGGCAGCCCTCCCCTCCCTGGGG - Intronic
915279912 1:154815280-154815302 GGGCAGCCTCCACCTCCCTTCGG + Intronic
915300251 1:154947603-154947625 AGCCAGGCCCCACCTGCCTCTGG + Intronic
915575258 1:156771561-156771583 CACCACCCCCCAGCTGCCTGAGG - Intronic
915594015 1:156886198-156886220 CGGCAGGTCCCAGCTGCCTGGGG + Intergenic
916361890 1:163979502-163979524 TGGCACCCCACACCTGACTGGGG - Intergenic
919804202 1:201371196-201371218 AGGCAGGGTCCACCTGCCTGGGG + Intronic
920296531 1:204960722-204960744 CTGCAGCCCCCACCTGCCCTTGG + Intronic
922067296 1:222156772-222156794 AGGCAGCAGCCACCAGCCTGGGG - Intergenic
923145559 1:231195346-231195368 CGGTAGCCGCTAGCTGCCTGTGG - Intronic
923657829 1:235933576-235933598 AGGCAGCCTCTACCAGCCTGTGG - Intergenic
1063187636 10:3665376-3665398 CAGCATCTCTCACCTGCCTGGGG - Intergenic
1063503950 10:6579957-6579979 CGGCGGCCCCCACCCGGCTAAGG + Intronic
1067318822 10:45198571-45198593 CGGCAGGTGCCACCTGCATGCGG - Intergenic
1067711813 10:48656227-48656249 CGGGAGCTCCGTCCTGCCTGAGG - Intronic
1067722952 10:48743414-48743436 CGGCACCCTCCACTTGCGTGGGG + Exonic
1067832948 10:49620880-49620902 CCACAGCCTCCACCTGGCTGAGG + Intronic
1069712860 10:70500994-70501016 CAGGAGCCCCCACCTGCTGGTGG - Intronic
1069906301 10:71734525-71734547 TGCCACCCTCCACCTGCCTGAGG - Intronic
1071336036 10:84601193-84601215 AGGCAGCGCCCACCTTCCTGTGG - Intergenic
1071875314 10:89837733-89837755 CGGCGGCCCCCTGCTGTCTGCGG + Intergenic
1072539967 10:96390792-96390814 CGGCAGCCCCCAGCCACATGTGG + Intronic
1073106717 10:101036480-101036502 AGGCTGTCCCCAGCTGCCTGTGG - Exonic
1073379322 10:103066049-103066071 CTGCAGCCCCCAGCGGCCTGTGG + Intronic
1073578026 10:104641353-104641375 CGGCGCCCCCGGCCTGCCTGCGG - Exonic
1075882803 10:125868892-125868914 TGGCAGCCATCACCTTCCTGAGG + Intronic
1076199532 10:128547198-128547220 CAGCAGCCACCCCCAGCCTGAGG + Intergenic
1076754052 10:132558852-132558874 CTGCAGCGCACAGCTGCCTGAGG - Intronic
1076930616 10:133529336-133529358 CGGCAGCCGCCGCCTCGCTGAGG - Intronic
1077023907 11:431198-431220 CGGGAGCCCCCACACCCCTGCGG - Intronic
1077052964 11:575996-576018 CTGCAGCCCCGCCCTGCCTCGGG - Intergenic
1077076950 11:706279-706301 CCGCAGCGCTCACCTGCCTCCGG - Exonic
1077140734 11:1023783-1023805 CCGCAGCCCCCAGCTGCCCAGGG - Intronic
1077219739 11:1410694-1410716 CAGGAGCCCCCGCCTGCCTAGGG + Intronic
1077239364 11:1502613-1502635 TGGCAGCCCCCAGCGCCCTGAGG + Intergenic
1077445518 11:2588864-2588886 CCGCGGCCCCCAACTGCCTGAGG - Intronic
1077459753 11:2703098-2703120 TGGCAGCCCCCATCTGCCTCTGG - Intronic
1078390260 11:10931042-10931064 CGGCATCCTCCTCCAGCCTGGGG + Intergenic
1079393670 11:20043521-20043543 CTGCAGCCTCCACCTCCCCGGGG + Intronic
1079459687 11:20669174-20669196 CGGCAGCCCCCACCGCGGTGCGG + Intergenic
1080386328 11:31813083-31813105 CGGCAGCCCTCCCCAGCCCGGGG - Intronic
1081685899 11:45042784-45042806 GGGAAGCCCCCATCTGGCTGAGG + Intergenic
1082029469 11:47594135-47594157 CAGCTGCCCTCACCTGGCTGGGG + Exonic
1083170746 11:60922738-60922760 CTGCAGCCCCCACAGGCCTCAGG - Exonic
1083924041 11:65795323-65795345 GGGCAGCCCCCACCTGTGAGTGG + Exonic
1084063970 11:66692937-66692959 CGGCAGCCCGGCCCAGCCTGGGG - Intronic
1084400061 11:68938333-68938355 CCTCAGCCACCACCTGCCCGAGG + Exonic
1084594956 11:70111350-70111372 CGGCTCCCCCCACCTGTCCGAGG - Intronic
1084646020 11:70458583-70458605 CGCCATCACCCACCTGCCAGTGG + Intergenic
1085327045 11:75614221-75614243 ATGCAGCTCCCACCTCCCTGCGG + Intronic
1087027186 11:93661492-93661514 CGCCAGCCCCAGCCTGCCTAGGG - Intergenic
1089217460 11:116843223-116843245 CTCCAGCTCCCACCTACCTGAGG + Intergenic
1089613227 11:119681208-119681230 GGGCAGCCTCCAGCAGCCTGGGG - Intronic
1091150148 11:133320891-133320913 CGGCAGCACCCAGCTGGCTGAGG + Intronic
1092106231 12:5923481-5923503 GGCCAGCCCCCACCTCCCTCGGG + Intronic
1092961791 12:13602988-13603010 TAGCAGCCTCCACCTCCCTGTGG + Intronic
1094643901 12:32302391-32302413 CGGGAGCACACACCAGCCTGGGG + Intronic
1097836939 12:64282690-64282712 CTGCAGCCTCGACCTCCCTGGGG - Intronic
1099314979 12:81073285-81073307 CTGCAACCTCCACCTCCCTGAGG + Intronic
1100270570 12:93020698-93020720 CTGAAGCCCCCATCAGCCTGAGG - Intergenic
1101330742 12:103755744-103755766 AGGCAACCCCTCCCTGCCTGAGG - Intronic
1101753238 12:107600688-107600710 AGGCAGCAGCCATCTGCCTGGGG - Intronic
1101901285 12:108792768-108792790 CAGCAGCCTCCAGCAGCCTGTGG - Exonic
1102068263 12:109996588-109996610 CTGCAGCCACAACCTTCCTGAGG + Intergenic
1102455113 12:113066102-113066124 CAGCAGCCCCTAGCTGCCTCTGG + Intronic
1104003148 12:124873334-124873356 CGCCAGCCCCCATCTCCCTGTGG - Intronic
1104969876 12:132526493-132526515 CGCCAGCTCCCAGCTGCCAGAGG - Intronic
1105012710 12:132766398-132766420 CGCCAGCCCTCAGCTGCCTTGGG + Intergenic
1105280334 13:18959424-18959446 CTGCAGCCACCACCTCCCTCAGG - Intergenic
1106410955 13:29511206-29511228 CCGCTGCCCCCACCATCCTGCGG + Exonic
1107295320 13:38901294-38901316 CTGCTGCCCTCACCTGCCTGAGG - Intergenic
1112842691 13:103600080-103600102 CGGCTGGCCCCACCGGCCCGGGG + Intergenic
1113568957 13:111339653-111339675 AGGGAGCCCTCGCCTGCCTGCGG + Intronic
1113964083 13:114142680-114142702 CGGCAGCCCCCACCTGCCCGAGG + Intergenic
1114523176 14:23351739-23351761 CGACAGCCCTCACCTGTCTGCGG + Exonic
1117157140 14:52951632-52951654 CGGCACCTCTCACCTCCCTGAGG - Intronic
1119024918 14:71144902-71144924 TGGCAGCCACCACCGTCCTGGGG - Intergenic
1119074439 14:71621692-71621714 CAGAAGCCCCCACCCTCCTGGGG - Intronic
1121885770 14:97541408-97541430 CTGTTTCCCCCACCTGCCTGGGG - Intergenic
1122286351 14:100654982-100655004 CCGCAGCACCCACTTGCCCGGGG + Intergenic
1122873058 14:104650377-104650399 TTGCAGCCCCCGCCTGACTGCGG + Intergenic
1123447076 15:20339231-20339253 TAGCATCCCCCATCTGCCTGTGG + Intergenic
1124017412 15:25889113-25889135 CTGCTGCCCCCACATTCCTGTGG + Intergenic
1124640463 15:31393200-31393222 CGCCAGCCCCCACCCTGCTGGGG + Intronic
1127404560 15:58628641-58628663 CAGCAGCCCCTACCATCCTGGGG + Intronic
1128944266 15:71810713-71810735 GGGCAGCCTCTGCCTGCCTGCGG - Exonic
1129150595 15:73685168-73685190 CCTCACCCCCCACCTCCCTGAGG - Intronic
1129690417 15:77710132-77710154 CGGCAGCCCCTGCCCCCCTGGGG - Intronic
1130297700 15:82658938-82658960 CTGGAGGCCCCACCTGGCTGGGG - Intergenic
1130651180 15:85763018-85763040 CGGCAGCCCCCCCATGCTGGAGG + Intronic
1130720051 15:86377710-86377732 TGGCAGCCCCCACCTGGACGAGG - Intronic
1131090662 15:89622649-89622671 CGGAAGACCCTGCCTGCCTGGGG - Intronic
1131529640 15:93180450-93180472 CAGCAGTCTCCCCCTGCCTGGGG - Intergenic
1132640096 16:974317-974339 GGGCAGGGCCCACGTGCCTGTGG - Intronic
1132687836 16:1169679-1169701 CAGCTGCCCCCAGCGGCCTGTGG - Intronic
1132729979 16:1356443-1356465 GGCCAGCCCCCACCTGTCTCAGG + Intronic
1132763214 16:1521188-1521210 CGGCAGCCTCCACCTCCCCAGGG + Intronic
1133658457 16:7890295-7890317 TGGCAGCCTCCAGGTGCCTGTGG + Intergenic
1135330653 16:21557172-21557194 CTGCGGCCCCTGCCTGCCTGGGG - Intergenic
1136183273 16:28569778-28569800 TGACAGCCCCCACATGCCTTCGG - Intronic
1136220170 16:28823417-28823439 CGGCCGCCTCCCCCTGCCTGGGG + Exonic
1136283072 16:29225506-29225528 TTGCAGCCCCCACTTGCCAGGGG - Intergenic
1136284089 16:29231125-29231147 GGGCCGCCCCTACCTGACTGTGG - Intergenic
1136289031 16:29260565-29260587 CAGTAGCCCCCTGCTGCCTGGGG - Intergenic
1136419684 16:30123815-30123837 CTGCAGCCTCAACCTCCCTGGGG + Intergenic
1136775843 16:32871426-32871448 CGGTAGCCCCAGCCTGCCTGGGG + Intergenic
1136894773 16:33990086-33990108 CGGTAGCCCCAGCCTGCCTGGGG - Intergenic
1137675206 16:50300709-50300731 TGGCCTCCCGCACCTGCCTGGGG - Exonic
1138454788 16:57115126-57115148 CCACAGACCCCACCTGCCTCAGG - Intronic
1139477259 16:67208898-67208920 TGGTAGCTCCCTCCTGCCTGTGG - Intronic
1139631494 16:68234473-68234495 GGGCCTCCCCCACCTGTCTGAGG - Intronic
1141461675 16:84181647-84181669 CTGTAGCCCTCACCTGCCCGGGG - Exonic
1141550454 16:84803405-84803427 CTGGAGCCCCTACCTGCCTCGGG + Intergenic
1141758139 16:86008400-86008422 TGGCCCTCCCCACCTGCCTGTGG + Intergenic
1142043677 16:87911639-87911661 CTGCGGCCCCTGCCTGCCTGGGG - Intronic
1142089121 16:88200633-88200655 GGGCCGCCCCTACCTGACTGTGG - Intergenic
1142094763 16:88233492-88233514 CAGTAGCCCCCTGCTGCCTGGGG - Intergenic
1142210990 16:88808397-88808419 CTGCAGCCCACATCTGCCTCTGG - Exonic
1203078259 16_KI270728v1_random:1133535-1133557 CGGTAGCCCCAGCCTGCCTGGGG + Intergenic
1143513781 17:7409185-7409207 AGGCAGCCCTCACCAGCCAGGGG - Intronic
1143596135 17:7915477-7915499 CTGCAGCTCCCACCTTCCTTCGG + Intergenic
1143902379 17:10183946-10183968 CTGCTGCCCCCACCTCCCAGGGG + Intronic
1143963757 17:10741437-10741459 GGGCAGCCACCTCCTCCCTGAGG + Intergenic
1144665866 17:17101953-17101975 CCTCAGCCCCCAGCTCCCTGCGG - Intronic
1145241428 17:21242834-21242856 TGCCAGACCCCACCTGCCAGCGG - Exonic
1146282926 17:31557222-31557244 GGGCAGGCCCTATCTGCCTGTGG + Intergenic
1147448695 17:40490495-40490517 CCTCAGCTCCCACCTGCCTGGGG + Intronic
1147457631 17:40548031-40548053 ACACAGCCCCCACCTGCCAGGGG - Intergenic
1148850864 17:50554441-50554463 CCTCACCCCCCACCTGCTTGAGG - Exonic
1150004634 17:61462356-61462378 GGGGAGCCCCCATCTGTCTGGGG + Intronic
1150788999 17:68184947-68184969 CCTCAGCCTCCACCTCCCTGGGG - Intergenic
1151310777 17:73291298-73291320 CTGCAGCCCCCTCCTCGCTGGGG - Intronic
1151431068 17:74063609-74063631 TGGGAGGCCCCACCTGCCTGTGG - Intergenic
1151717386 17:75838049-75838071 CCGAATCACCCACCTGCCTGAGG + Intronic
1151767547 17:76140147-76140169 CGGCCGACCCCGCCTGCCTGGGG - Exonic
1151836444 17:76585671-76585693 CGGCAGCCCCTACCTGGCTCCGG + Exonic
1151967653 17:77439796-77439818 CTGCAGGCCCCCGCTGCCTGGGG + Intronic
1152286524 17:79416103-79416125 GGGCAGCCCTGCCCTGCCTGGGG - Intronic
1152567252 17:81105848-81105870 CGGCAGCTCCCACCAGGTTGAGG + Intronic
1152569787 17:81116582-81116604 GGGAAGCCCCCACCTGCCAGCGG - Exonic
1152638201 17:81438817-81438839 CTGCAGCCCCCAGCAGCCCGGGG + Intronic
1152816291 17:82410044-82410066 AAGCTTCCCCCACCTGCCTGGGG - Intronic
1152848580 17:82617767-82617789 GGGCAGCCTGCACCTTCCTGAGG - Intronic
1153824976 18:8866799-8866821 CAGCTGCCACCAGCTGCCTGTGG + Intergenic
1160298573 18:77658722-77658744 GGGCAGCCCCCGCCAGCATGGGG - Intergenic
1160984900 19:1833983-1834005 CTGCTGCCCACCCCTGCCTGGGG - Intronic
1161217772 19:3103010-3103032 AGGAAGCCCCCACCAGGCTGCGG - Intronic
1161256943 19:3314889-3314911 CGGCCGCCCCCTCCTGCCCCCGG - Intergenic
1161941029 19:7404199-7404221 GGGCAGCCCGTACCTGCCTCTGG - Intronic
1161993969 19:7701235-7701257 CGCCACACCCCACCTCCCTGAGG - Intronic
1162211258 19:9093964-9093986 CTGCAGCTCCCACCTGTCTGTGG + Exonic
1162490664 19:10989434-10989456 TGCCAGCACCCACCTGCCTCTGG - Exonic
1162720418 19:12658540-12658562 CGGGAGTCCGCACCTTCCTGGGG + Intronic
1163255706 19:16154512-16154534 TGGCACCTCCCACCTGGCTGAGG + Intronic
1163606913 19:18280783-18280805 CGGCGGCCCCAACGCGCCTGGGG + Exonic
1163797546 19:19346115-19346137 TGGCAGCACCCACAGGCCTGCGG - Intronic
1163856370 19:19705655-19705677 CTGCAGCCTCCACCTCCCAGAGG + Intergenic
1164168442 19:22702863-22702885 AGGCACCCCCCACCTCCCTCCGG + Intergenic
1164507609 19:28872356-28872378 CTTCAGCACCCACCTGCCTGAGG - Intergenic
1164528550 19:29029610-29029632 GGGCTGCTCACACCTGCCTGTGG + Intergenic
1164833099 19:31338192-31338214 ACACAGCCCCCAGCTGCCTGAGG - Intronic
1165013280 19:32863915-32863937 CTGCAGCCCCCACGGGCCTGGGG + Intronic
1165279268 19:34782809-34782831 AAACAGCCCCCACCTGCCTCAGG + Intergenic
1165831472 19:38732735-38732757 CCCCAGCCCCCATCTCCCTGTGG + Intronic
1166216417 19:41338416-41338438 CGGCAACCTCCACCTCCCGGGGG - Intronic
1167260739 19:48456260-48456282 CTGCAGCCCTCCCCAGCCTGGGG - Exonic
1167387156 19:49170712-49170734 CCTCAGCCCCCTCCTCCCTGGGG + Intronic
1167494591 19:49810153-49810175 CGGCAGCCTCCACCTCCCCCAGG - Intronic
1168435142 19:56310677-56310699 GGGCTGCCCCCACCGTCCTGAGG + Intronic
925697601 2:6597356-6597378 GTGCAGCCCCCACATCCCTGAGG + Intergenic
926142659 2:10377596-10377618 CGGCAGCCCCCTCCTCCCCCTGG + Intronic
926147370 2:10404919-10404941 CCGCAGCCCCCACCTCCCGCCGG + Intronic
926765723 2:16321363-16321385 AGGCAGCTCCCAGCTGCCTCGGG - Intergenic
927553364 2:24017120-24017142 TGGCTGCCCCCTCCTGCCTTTGG + Intronic
928175166 2:29028424-29028446 CAGCAGCCCCGCCCTGCCTGGGG + Intronic
929243506 2:39676761-39676783 CGGCAGTCCCATCCTGCCTATGG + Intronic
930608646 2:53517711-53517733 AGGCAGCCCCCACTTGCCATTGG - Intergenic
932106549 2:68948379-68948401 GGGAAGCCCCCAGCCGCCTGTGG - Intronic
934738952 2:96705318-96705340 ATGCAGTCCCCACCTGCCTTGGG - Intergenic
936721414 2:115256005-115256027 CGGCAGCACCCAACTTTCTGTGG + Intronic
937836130 2:126471929-126471951 GGGCAGGTCCCACCTGCCAGAGG - Intergenic
937887917 2:126912704-126912726 TGGCTGTCCCCATCTGCCTGTGG - Intergenic
937914174 2:127090746-127090768 GGCCAGCACCCACCTGCCTTGGG + Intronic
938320106 2:130356594-130356616 CTGCAGCCCCTTCCTTCCTGTGG - Intronic
940748435 2:157597130-157597152 AGACAGCACCCACCAGCCTGAGG + Intronic
944573802 2:201071746-201071768 CGGCAGCCCCGCCCTGTGTGCGG + Exonic
946809768 2:223511288-223511310 CAGCAGCCCCCACTGCCCTGTGG - Intergenic
947749907 2:232526523-232526545 GTTCAGCCCCCAGCTGCCTGGGG - Exonic
948484803 2:238273741-238273763 CGGCAACCTCCACCTCCCAGGGG + Intronic
948572510 2:238926707-238926729 CAGGAGCCCCCACCTTCCTGTGG + Intergenic
948831057 2:240598468-240598490 AGGCAGAAACCACCTGCCTGAGG - Intronic
948921673 2:241068812-241068834 CCGCAGTCACCTCCTGCCTGGGG + Intronic
1171238744 20:23548343-23548365 CCTCAGCCTCCACCTGCCTCAGG + Intergenic
1171242861 20:23585895-23585917 CCTCAGCCTCCACCTGCCTCAGG - Intergenic
1172006443 20:31821743-31821765 CCCCAGCCCCCACCTGCCCCTGG - Intronic
1172782282 20:37443958-37443980 CGTAAGCTCCCATCTGCCTGGGG + Intergenic
1172966656 20:38840311-38840333 CAACCTCCCCCACCTGCCTGGGG + Intronic
1172991760 20:39041692-39041714 CTGCTGCCACAACCTGCCTGGGG - Intergenic
1173332323 20:42085666-42085688 CGGCAGCCTCCATCTGTCTTGGG + Intronic
1173596950 20:44264572-44264594 CTGCAGCCCCCACCTCCCCCAGG - Intronic
1173937581 20:46880815-46880837 GGGAAGCCACCTCCTGCCTGGGG - Intergenic
1174327420 20:49790443-49790465 CAGCGCCCCCCACCTGCCTTAGG + Intergenic
1174411474 20:50339466-50339488 CAGCCACCCCCAGCTGCCTGCGG - Intergenic
1174452019 20:50626277-50626299 GGGCAGCCCCCACCTGGCCTTGG - Intronic
1174576710 20:51542462-51542484 CGGCAGCCCCAACCCGACGGCGG - Exonic
1174824578 20:53757774-53757796 CGGGAGCCACCTCCTGACTGAGG + Intergenic
1175460152 20:59146337-59146359 CGGCAGCCCCCACCTGCCTGTGG + Intergenic
1175466919 20:59195543-59195565 CGGGAGCCCCCACACCCCTGGGG - Intronic
1176973334 21:15290348-15290370 CGCCAGCCCCCTGCTGCCTCAGG - Intergenic
1176976256 21:15326194-15326216 GGGCTGCCCCCACCTTCGTGTGG + Intergenic
1177066274 21:16440563-16440585 CTGCAACCTCCACCTCCCTGAGG + Intergenic
1178570926 21:33736532-33736554 CAGCAGCCTCCACATGACTGGGG + Intronic
1179823870 21:43952910-43952932 GGGCAGCCCCCAGCACCCTGGGG - Intronic
1181030309 22:20146268-20146290 CCGCAGCCCCGGCCTGGCTGCGG + Intronic
1181362300 22:22347294-22347316 CAGCAGCCCCCAGATGCCTGGGG - Intergenic
1181672353 22:24431629-24431651 CAGCCGCCACCACCTGCCTGGGG - Intronic
1182430745 22:30297561-30297583 CTGTAGCCTCCACCAGCCTGAGG + Intronic
1182761345 22:32724789-32724811 CAGCAGCCCTCTCCTCCCTGGGG - Intronic
1183217377 22:36489766-36489788 AGGCAGCTCCCACCTGGCAGAGG + Exonic
1183310829 22:37108684-37108706 CTGCAGCCTCCAACAGCCTGGGG + Intronic
1183758141 22:39790012-39790034 GTCCAGCCCCCTCCTGCCTGTGG - Intronic
1183784452 22:40021503-40021525 AGGCTGCCGCCACCCGCCTGGGG + Exonic
1183952022 22:41357539-41357561 AGGCAGCCCCCAGCCCCCTGAGG + Exonic
1184248480 22:43247552-43247574 CAGCAGCTCCCAGCTTCCTGAGG - Intronic
1184620408 22:45672204-45672226 CGGCCGCCCTCCCCTGCCCGGGG - Intronic
1184841936 22:47057197-47057219 CGGCAGCCTCAACCTGACTGAGG - Intronic
1185242008 22:49751748-49751770 CTCCAGCGCCCACCTGGCTGTGG + Intergenic
1185266010 22:49904324-49904346 CCCCAGCACCCACCTGTCTGGGG + Exonic
1185299617 22:50072561-50072583 CCGCAGACCCCTCCTGCCTCGGG - Intronic
950568682 3:13786977-13786999 CGGCAGCCACCAGCCGCGTGTGG - Intergenic
951146593 3:19234502-19234524 CGGCCAGCCCCACCCGCCTGGGG - Intronic
951362151 3:21738089-21738111 CCTCAGGCCCCACCTGCCAGGGG + Intronic
952764849 3:36944949-36944971 CGGGGGCCCCCAGCTGCCTGCGG + Exonic
953646292 3:44758938-44758960 CTGCAGCCTCAACCTACCTGGGG + Intronic
953688034 3:45093580-45093602 TGACATCCTCCACCTGCCTGTGG - Exonic
953918379 3:46935250-46935272 CCACAGCCACCACCTCCCTGTGG - Intronic
956835685 3:73094552-73094574 CTGCAACCTCCACTTGCCTGTGG + Intergenic
960571401 3:119188564-119188586 CTTCAGCTCACACCTGCCTGTGG + Intronic
961536379 3:127573365-127573387 CTGGAGGCCCCACCTCCCTGGGG - Exonic
961541966 3:127606293-127606315 CCGCATCTCCCACCTGCCTCTGG + Exonic
961700805 3:128743183-128743205 CGGCTGGCGCCACCGGCCTGGGG - Intronic
962848195 3:139288940-139288962 CTCCAGCCCACACCTGCCTAGGG - Intronic
964720494 3:159764281-159764303 CGGGAGCCAGCACCAGCCTGAGG - Intronic
964946099 3:162225515-162225537 CCACAGCCCTCACCTGGCTGAGG - Intergenic
965716922 3:171614730-171614752 CAGCAGCCCCCGCCTGACAGCGG - Intronic
965763543 3:172106715-172106737 CTGCAGCCCCCACCTGCAAAGGG - Intronic
966198179 3:177334441-177334463 CGTCCTCCACCACCTGCCTGGGG + Intergenic
966850897 3:184164493-184164515 TGGCTGCCCCCACCAGCATGAGG - Exonic
966923883 3:184631955-184631977 CAGCCGCCCTCACTTGCCTGTGG - Intronic
967134590 3:186502674-186502696 CGGCACCTCCCACCTTCCTTAGG - Intergenic
967852980 3:194095943-194095965 TGGCATCCCCAGCCTGCCTGTGG + Intergenic
968569119 4:1330069-1330091 CTGCAGCTCCGCCCTGCCTGGGG + Intronic
968573301 4:1353637-1353659 TGGCAGCCCCCACCTCAGTGAGG + Intronic
968581421 4:1397085-1397107 CTGTGGCCCCCACCTGCCTCTGG - Intergenic
968702778 4:2064679-2064701 CCCCAGCCCCCAGCTGGCTGTGG + Exonic
969175996 4:5399533-5399555 CAGCAGCCCCAAGATGCCTGGGG + Intronic
969308857 4:6340563-6340585 CAGCAGGCCCCACCTGCCATGGG + Intronic
969570279 4:8004287-8004309 CTTCACCCCCAACCTGCCTGTGG - Intronic
971343971 4:25795700-25795722 AGGCAACCCCCACCTGGGTGTGG - Intronic
972684640 4:41340010-41340032 CGGCTGCCCCCTCCTGCCCCTGG - Intergenic
973589133 4:52422886-52422908 CTGCAGCAACCTCCTGCCTGGGG - Intergenic
974589064 4:63919876-63919898 CAGCAGTCCCCACAGGCCTGGGG - Intergenic
975132363 4:70842116-70842138 CAGCAGCCCTCACCTCCCTTTGG + Intergenic
977227181 4:94406369-94406391 CTGCAGCCTCGACCTCCCTGGGG - Intergenic
977816416 4:101418198-101418220 TGGCAGCCACATCCTGCCTGTGG - Intronic
978463625 4:108984612-108984634 CGGCTGGCCCCACCTGCCGCGGG - Intronic
980130658 4:128812613-128812635 CGGCCGCCCCCACCCGCTTGGGG - Intronic
980774480 4:137421120-137421142 CGGCCGGCCCCGCCTGCCCGGGG + Intergenic
983186322 4:164705205-164705227 CGGCAGCCTGCACTTGTCTGGGG - Intergenic
985509543 5:305064-305086 CTGCAGCTCCCACCTGGCTACGG - Intronic
985618140 5:936943-936965 CTGCAGCCCCCTCATGTCTGAGG + Intergenic
985673713 5:1219499-1219521 CTGCAGGCCTCATCTGCCTGGGG + Exonic
985745155 5:1642649-1642671 TGGCGGCCCCACCCTGCCTGTGG - Intergenic
986810967 5:11359602-11359624 CAGCAGTGCCCACCTGCCCGAGG - Intronic
989063910 5:37440421-37440443 CTGCAGCCTCCACCTCCCAGGGG + Intronic
990703612 5:58502128-58502150 CAGCAGTCCCCTCTTGCCTGTGG - Intergenic
992759145 5:79936173-79936195 CATCAGCCCCCAGCTGCTTGAGG + Intergenic
993634918 5:90331898-90331920 CTGCAGCCACCACCTGGTTGAGG - Intergenic
994462243 5:100078909-100078931 CTGCAGCCTCCACCTCCCAGGGG - Intergenic
997383204 5:133452026-133452048 CAGGAGCCCACACCTGGCTGGGG + Intronic
997384120 5:133459056-133459078 CAACAGACCCCACCTGCCTCTGG + Intronic
997518409 5:134506637-134506659 CTTCAGCCCCCTCCTGCCTTTGG + Intergenic
997627603 5:135341577-135341599 TGGCAGTGCCCATCTGCCTGTGG + Intronic
998095072 5:139392177-139392199 CGGCAGCCCCCAGCTACCCTGGG - Exonic
999270389 5:150293512-150293534 AGGCACCCCCCACCTTCCTGAGG + Intergenic
999718246 5:154379440-154379462 GGGCAGCCAGCAGCTGCCTGGGG - Intronic
1001281715 5:170390850-170390872 AGGCTGCACCCACCTCCCTGGGG - Intronic
1001708131 5:173756848-173756870 CTGCAGCCCCCACCTGACTCTGG + Intergenic
1002321532 5:178378791-178378813 CGGCCGCTGCCACCTGCCAGCGG - Intronic
1003861905 6:10330199-10330221 CTGCAACCTCCACCTGCTTGAGG + Intergenic
1005922426 6:30414617-30414639 CTGCTGCCCCGACCTTCCTGAGG - Intergenic
1006385229 6:33727025-33727047 GGGCAGCCCTCACCAGGCTGGGG + Intronic
1007547475 6:42705149-42705171 CAGGAGCTCCCACCTGGCTGGGG - Intronic
1012475671 6:99613357-99613379 GGGCTGCCCCCACTTGCCTGGGG - Exonic
1016140726 6:140606693-140606715 AGGCACCCCCCACCTGCCCCAGG + Intergenic
1016210779 6:141531338-141531360 CGGAAGCCCCCTGCTGCCTCAGG + Intergenic
1017747325 6:157458607-157458629 CCACAGCCCCCACCTGCCCCAGG - Intronic
1018206516 6:161441797-161441819 CTGCAGCTGCCACCTGCCTGGGG + Intronic
1019120788 6:169801981-169802003 CGGCTGCGACCCCCTGCCTGGGG + Intergenic
1019213247 6:170423081-170423103 CGGCAGCGCCCTCCAGGCTGGGG - Intergenic
1019400969 7:853609-853631 CGGCAGCACCCACCTCCCTCGGG - Exonic
1019434429 7:1014884-1014906 CTACAGCCCCTTCCTGCCTGCGG + Intronic
1019485580 7:1287889-1287911 CGACGCCCCCCACCTTCCTGCGG + Intergenic
1019536697 7:1533178-1533200 CACCAGACCCCACCGGCCTGTGG - Intronic
1019651055 7:2158838-2158860 CTGCAGGAGCCACCTGCCTGAGG + Intronic
1019659892 7:2218339-2218361 CCACAGCTCTCACCTGCCTGCGG + Intronic
1019676242 7:2314289-2314311 CGGTAGCCCCCACCTGCCCAGGG - Intronic
1020461549 7:8434321-8434343 CGGCTTCCCACAGCTGCCTGAGG - Exonic
1023746366 7:43326313-43326335 CGACAGCCCCTACCTGTGTGAGG - Intronic
1029307616 7:99631998-99632020 CCCCAGTCCCCACCTGCCTTTGG - Exonic
1029465292 7:100721134-100721156 GGGCAGCCTCCACGTGCCAGCGG + Intronic
1030023730 7:105301335-105301357 CGGCAGCGCCCAGCTGCCAGCGG - Intronic
1032081474 7:128860576-128860598 CGGCTGCCTCCACCTGTGTGTGG + Intergenic
1033558332 7:142508217-142508239 CCCCAGCCCCCACCCTCCTGTGG + Intergenic
1035278095 7:157759989-157760011 CAGCAGCCCCTACCTGTCAGGGG + Intronic
1035704045 8:1661255-1661277 CTGCAGCCCCCACCACCATGAGG - Intronic
1036594553 8:10200341-10200363 GGGCAGCCCCCACTTGCATATGG + Intronic
1038335439 8:26641857-26641879 CAGCTGCCCCCTCCTGCCTCAGG - Intronic
1039407411 8:37325365-37325387 CAGCATCCCCCACCTGCCAAGGG + Intergenic
1039461388 8:37748375-37748397 CGGCACCTCACACCTGCCAGGGG - Intronic
1040043619 8:42940131-42940153 CTGCAGCCTCCACCTCCCGGCGG - Intronic
1041384100 8:57280238-57280260 CAGCAGCTGCCACCTGCATGCGG + Intergenic
1041449264 8:57990032-57990054 GGGCAGCCATCAGCTGCCTGTGG + Intergenic
1045119270 8:99017570-99017592 CTGCAACCTCCACCTCCCTGTGG + Intronic
1045443700 8:102239253-102239275 CGGCAAGCCCCGCCTGCCTTGGG + Intergenic
1045489547 8:102657654-102657676 CAGCAGGCCCCACATTCCTGAGG - Intergenic
1047783131 8:128125989-128126011 CTGCAGACCCCACCTGGCTCTGG - Intergenic
1048793669 8:138128664-138128686 CTGCAGCCCCCACAAGCTTGGGG - Intergenic
1048968419 8:139630398-139630420 CCGCCGCCCCCACCTCCCCGGGG + Intronic
1049195890 8:141315430-141315452 CGGCAGGCCCCACCTGCTGATGG + Intergenic
1049235613 8:141510814-141510836 AGGAAGGCCCCACCTTCCTGAGG - Intergenic
1049438565 8:142598828-142598850 CAGCAGCCCCCGCCTGCCACCGG - Intergenic
1051641634 9:19230101-19230123 AAGCAGCCGCCACCTGCCTCAGG + Intergenic
1052990159 9:34514330-34514352 CAGCAGCCACCACTTCCCTGGGG - Intronic
1057204507 9:93163247-93163269 CCCCAGGCCACACCTGCCTGAGG - Intergenic
1057210429 9:93198340-93198362 CAGCAAGCCCCGCCTGCCTGGGG - Intronic
1059344784 9:113620778-113620800 ATGCAGCCCCCACTTGCCTGAGG - Intergenic
1059528395 9:115014169-115014191 TGGCAGCCTCCACCTGGCTTCGG - Intergenic
1060769158 9:126318458-126318480 CTGCAGCCCTAACCTTCCTGAGG + Intergenic
1061450756 9:130665896-130665918 CGGCGGCCCCCAGCTCCCCGAGG - Intronic
1061808592 9:133149585-133149607 CAGCGGCCCCCGCCTGGCTGGGG - Intergenic
1061862621 9:133475747-133475769 CTGCAGCCCCACCCTGCCTGGGG - Intronic
1062116178 9:134810332-134810354 CGGCAGCCCCCAGGTCCCGGGGG + Intronic
1062207789 9:135346847-135346869 CTTCAGCTCCCACCTGCCCGAGG + Intergenic
1062346161 9:136116240-136116262 GGGCAGCGCCCACCTGCCGGTGG - Exonic
1062401676 9:136375502-136375524 AGGGACCCCCCACCTGGCTGGGG - Intergenic
1062462109 9:136666345-136666367 CCGCAGCCCCCACCCGCGAGAGG - Intronic
1062534800 9:137016722-137016744 GGGCAGCCCGTACATGCCTGGGG + Exonic
1062553811 9:137104797-137104819 CGGGTGCACACACCTGCCTGAGG + Intronic
1062600133 9:137315820-137315842 GGGCCGCTCCCACCTGCCTTGGG + Intronic
1062631400 9:137464726-137464748 CTGCAGCGCCCCCATGCCTGGGG + Intronic
1189291342 X:39888058-39888080 TTGCATCCCCCATCTGCCTGAGG + Intergenic
1192589174 X:72345756-72345778 CTGCAGCCTCAACCTCCCTGGGG + Intronic
1192891812 X:75398735-75398757 TGGCAGCCCACCCCTCCCTGTGG - Intronic
1194666853 X:96685201-96685223 CCGCAGCCCCCGCCGGCCTTAGG + Intronic
1199628100 X:149758667-149758689 CGGCTGGCCCCCCCTGCCCGGGG + Intergenic
1199635077 X:149806325-149806347 CGGAGGCCCCCACCTCTCTGGGG - Intergenic
1200104046 X:153702612-153702634 CGGTAGCCCCAGCATGCCTGGGG - Intronic