ID: 1175460159

View in Genome Browser
Species Human (GRCh38)
Location 20:59146353-59146375
Sequence CCTGTGGACTGAGCACTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175460145_1175460159 29 Left 1175460145 20:59146301-59146323 CCTGCCTCATCGGAGCCACCGGT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1175460159 20:59146353-59146375 CCTGTGGACTGAGCACTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1175460151_1175460159 11 Left 1175460151 20:59146319-59146341 CCGGTTTTCGGGAGAGAGCGGCA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1175460159 20:59146353-59146375 CCTGTGGACTGAGCACTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1175460149_1175460159 14 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460159 20:59146353-59146375 CCTGTGGACTGAGCACTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1175460146_1175460159 25 Left 1175460146 20:59146305-59146327 CCTCATCGGAGCCACCGGTTTTC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1175460159 20:59146353-59146375 CCTGTGGACTGAGCACTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175460159 Original CRISPR CCTGTGGACTGAGCACTTAA AGG Intergenic
906292819 1:44631166-44631188 TCAGTGGACTGACCACTTCAGGG - Intronic
907309293 1:53530096-53530118 CCTGGGCCCTGAGCACTTCATGG - Intronic
916556310 1:165896945-165896967 CCTGTGAACTGAGCTCTACAGGG + Intronic
917514518 1:175696414-175696436 CCTCTGGACTGAAGACATAAAGG + Intronic
918379127 1:183937144-183937166 CCTGTGGACTCTGCTCTGAAGGG + Exonic
918715448 1:187780455-187780477 CCAGTGGACTGTGAACTTCATGG + Intergenic
919315865 1:195969992-195970014 CCTGTGGGGTCAGCACTTCAAGG - Intergenic
919322836 1:196065006-196065028 CTTGTGGACTCAGCCATTAATGG - Intergenic
920653475 1:207856088-207856110 CCTATTTACTGAGCACTTGATGG + Intergenic
922026877 1:221758200-221758222 ACTGTGGGGTGAGCACTAAAGGG - Intergenic
922573575 1:226647510-226647532 GCTATGGACTGAGCACCTTAAGG + Intronic
1063390458 10:5646814-5646836 CGTGTGTACTGAGCTCATAAAGG + Intronic
1064709657 10:18110479-18110501 CTTGTGTACTGACCAGTTAATGG - Intergenic
1065299082 10:24304590-24304612 CCTGTAATCTCAGCACTTAAAGG - Intronic
1076109104 10:127847708-127847730 CTTGTCGACTCAGCACTTGATGG - Intergenic
1077351898 11:2096934-2096956 CCTGTGGAGTGGGCAGTTCACGG - Intergenic
1080043861 11:27787994-27788016 CCTTTGGACTGATGACTTAATGG + Intergenic
1083767934 11:64851113-64851135 CCCGTGGACTGAGGCCTTCAGGG - Intergenic
1084683590 11:70680981-70681003 CCTGTGGTCTGAGCATTGACGGG - Intronic
1088794186 11:113253661-113253683 CCAGTGGACTGATCCCTAAAAGG + Intronic
1089749880 11:120643431-120643453 CCTGTGGACTCTGCACATCAGGG + Intronic
1090229463 11:125091127-125091149 CCTGTGGGCTGAGGACTTGGAGG - Intergenic
1091400431 12:177701-177723 CCTGGGGACTGAGCAGGGAAGGG - Exonic
1092791999 12:12078399-12078421 GCTGTGGACTGTGGAGTTAAAGG - Intronic
1097054530 12:56241753-56241775 TGGGTGGACAGAGCACTTAAAGG + Exonic
1098702270 12:73644700-73644722 GCTGTGGACTGAGGAATCAAAGG + Intergenic
1098769729 12:74538001-74538023 CCGGAGGACTGGGCACTGAAAGG + Exonic
1103201546 12:119091901-119091923 CCTCTGGACTGTGCACTTGAGGG + Intronic
1105773484 13:23635052-23635074 CCTGTGGAATGAGGGCTTTAAGG - Intronic
1107823325 13:44305672-44305694 CCTGGGCACTGAGGACTCAATGG + Intergenic
1114387230 14:22267923-22267945 ACTTTGGAATGACCACTTAAGGG + Intergenic
1114549800 14:23526180-23526202 TCTGCAGACTGTGCACTTAAAGG + Exonic
1114745031 14:25137252-25137274 CCTGGGGACAGAGCACTTGGGGG + Intergenic
1116490197 14:45496080-45496102 CCTGAAGACTGAGGACTTTAAGG + Intergenic
1118919057 14:70133344-70133366 CCTGTGGACTGACCACCCCAGGG - Intronic
1120068737 14:80078216-80078238 CATTTGGTCTGAGCACTGAAGGG - Intergenic
1120701399 14:87703260-87703282 ACTGTGGACAGAGGACTGAAGGG - Intergenic
1121597135 14:95172715-95172737 CCTGGGGACTGGGGACATAATGG + Intergenic
1122396614 14:101437343-101437365 CCTGTGGATTGACAACTTCAAGG + Intergenic
1124156543 15:27230417-27230439 TCTGAGGTCTGAGCACATAAAGG - Intronic
1124828320 15:33122471-33122493 ACTGTGGGCTGAGCAGTAAAAGG - Intronic
1126914650 15:53452545-53452567 CCTCTGGACTAATCACTCAAAGG - Intergenic
1130358810 15:83160926-83160948 CATGCTGACTGAGCAATTAAAGG - Intronic
1137037197 16:35577111-35577133 TCTGTGGAATGAGCCCTTACTGG - Intergenic
1137238157 16:46632770-46632792 GCTGAGAACTGAACACTTAATGG - Intergenic
1137555430 16:49467445-49467467 CATGTGGCCTCACCACTTAACGG - Intergenic
1138113840 16:54344764-54344786 CCTGAGGGCTGAGCAGTGAAGGG + Intergenic
1138403793 16:56771663-56771685 TCTGTGGACTGTGCACTGAGTGG + Intronic
1139485059 16:67250872-67250894 CTTGTGGTCTGAGGACTTAAAGG + Intronic
1139820234 16:69715207-69715229 CCTGGGGAGTTAGCACTTTAAGG + Intronic
1140033682 16:71357702-71357724 CCTGCGGTCTGAGCCCTTAGGGG - Intergenic
1142154489 16:88526976-88526998 CCCCTGGGCTGAGCCCTTAAAGG + Intronic
1151459517 17:74246178-74246200 CCTGGGGACAGAGAACTTCAGGG + Intronic
1152896084 17:82912171-82912193 CCTGTGGACTGAGCAGCGCAGGG + Intronic
1155618579 18:27749359-27749381 CCTGTGGAATGAGCACTCCTGGG + Intergenic
1156478539 18:37421632-37421654 CCTGTGGCCTGAGCACACAGTGG + Intronic
1158518152 18:58147897-58147919 CCTGTGGACAGAGCAGTCACTGG - Intronic
1158683804 18:59594501-59594523 CCAGTGAACTGCTCACTTAATGG + Intronic
1159178796 18:64874487-64874509 CCTGTGGACTGAGCTGATCAGGG - Intergenic
1160363973 18:78308566-78308588 CCCCTGGACTGAGGGCTTAAAGG + Intergenic
1162009198 19:7801479-7801501 CCTCTGGCCTGGGAACTTAATGG + Intergenic
1162039921 19:7964419-7964441 ACTGAGGACTGAGAACTCAAGGG + Intronic
1162896359 19:13766696-13766718 CCTGGGAACTGAGGCCTTAATGG + Intronic
1163904857 19:20143515-20143537 ACTGTGGACTGAAAACTTAGCGG - Intergenic
1163984066 19:20928459-20928481 ACTGTGGACTGAAAACTTAGAGG + Intronic
1164099745 19:22044242-22044264 TCACTGGACAGAGCACTTAATGG - Intergenic
1164237589 19:23350623-23350645 CCTGGGGTCTGAACGCTTAAGGG + Intronic
1168271127 19:55250399-55250421 CCTGTGTAGTGGACACTTAAGGG + Intronic
927465051 2:23330481-23330503 CCTTTGGTCTGTGCAGTTAAAGG - Intergenic
927547883 2:23970816-23970838 CCTGTGAACTGAGCATCCAAGGG - Intronic
929596958 2:43182042-43182064 CCTGTAATCTGAGCACTTTAGGG + Intergenic
930158487 2:48129163-48129185 GCTGTGGGCTGAGGACTGAATGG + Intergenic
930661618 2:54060046-54060068 TCATTGGGCTGAGCACTTAATGG + Intronic
933543975 2:83685967-83685989 ACTGTAGGCTGAGCACTTGAAGG - Intergenic
934707889 2:96497468-96497490 CCCATGGACTGAGCACATGAAGG - Intergenic
935223736 2:101036123-101036145 CCTGTGGAATGACCACTTTGTGG - Exonic
938646199 2:133332887-133332909 GCTGTGGACTAAGCCCTTCACGG + Intronic
939356659 2:141111507-141111529 CCTGTGTTTTGTGCACTTAAGGG + Intronic
1169090473 20:2858363-2858385 CCTGTAATCTGAGCACTTTAGGG - Intronic
1169199972 20:3704165-3704187 CCTTAGGACTGAGCTTTTAAAGG - Intronic
1170534584 20:17327359-17327381 CCTGTGTCCTGAGGACTTAGGGG - Intronic
1174127206 20:48315481-48315503 CCTGTGGACTGGGGAACTAAGGG - Intergenic
1175460159 20:59146353-59146375 CCTGTGGACTGAGCACTTAAAGG + Intergenic
1177101003 21:16897019-16897041 CCTGAGGACTGAGGACTGTAAGG - Intergenic
1179243241 21:39609925-39609947 CCTGTGGAAGGAGCACCTGAAGG + Intronic
1183215588 22:36477626-36477648 CATGTGGACTCAGAACTAAAAGG + Intronic
1183332606 22:37229496-37229518 GATGTGGACTGAGCACTTCCTGG - Intronic
1183839922 22:40490689-40490711 CCTGTGGAGTCAGCAATGAATGG - Intronic
1184582500 22:45426959-45426981 CCTGTGGCCTGAGCAACTAGAGG + Intronic
950455098 3:13088177-13088199 CCTGGGGACTCAGCAGTTACGGG - Intergenic
950630560 3:14279148-14279170 CCTGGGGATGGAGCAGTTAATGG + Intergenic
951577353 3:24127337-24127359 CCAGTGGACTGGGAACTTAAAGG - Intronic
953001976 3:38944026-38944048 ACTGTGTAATGATCACTTAAGGG - Intronic
956866937 3:73378425-73378447 CCTGTGGACTGTGCCCTTTCAGG + Intergenic
962413429 3:135161486-135161508 CCTTTTGCCTGAGCACTTGAAGG + Intronic
965759642 3:172062144-172062166 AATGGGGACTGAGCACTTCATGG - Intronic
965906177 3:173709332-173709354 CTTCTGGACTGAGCACATAATGG - Intronic
966643163 3:182212992-182213014 CCTGTGAACTGAGCTTTTCAGGG - Intergenic
969424636 4:7116991-7117013 CCTCTGGACTCAGCAGCTAAAGG + Intergenic
969702826 4:8777088-8777110 CCTGAGTACTGAGCACTCACCGG + Intergenic
969702850 4:8777204-8777226 CCTGAGTACTGAGCACTCACCGG + Intergenic
969702887 4:8777378-8777400 CCTGAGTACTGAGCACTCACTGG + Intergenic
969750551 4:9107245-9107267 CCTGAGGACTGAGGACTGTAAGG - Intergenic
976104750 4:81604767-81604789 CCTGTGGACTTAGCAAGGAATGG + Intronic
985700210 5:1367021-1367043 ACAGTGGACTCAGCACTAAAAGG + Intergenic
987778420 5:22399527-22399549 CATGTGGACAGAGCACATAATGG + Intronic
990340801 5:54821167-54821189 CCTGTGGAATGTGCACTTGCTGG + Intergenic
992173271 5:74124751-74124773 CGTGTAGATTGAGCACTTTATGG + Intergenic
999743438 5:154574170-154574192 CCTGTGCAGTGAGCACTGAGGGG - Intergenic
1003190562 6:3870847-3870869 CTTCTGGACTGAGCATCTAAGGG - Intergenic
1005226609 6:23650628-23650650 CGTGAGGAGTGAACACTTAAGGG + Intergenic
1006940855 6:37751411-37751433 CCTGTGGGCTAAGCGCTTTAGGG + Intergenic
1009512291 6:64568511-64568533 CCCTGGGACAGAGCACTTAAGGG + Intronic
1011727144 6:90221492-90221514 CGTGTGTAGTAAGCACTTAATGG - Intronic
1014005702 6:116415428-116415450 TCTGTGTACTGTGCACTTCATGG + Intronic
1015730448 6:136341450-136341472 TCTGTGCATTGAACACTTAAAGG - Intergenic
1017937898 6:159023162-159023184 CCAGTAGACTGAGAAGTTAAGGG + Intergenic
1019042390 6:169117995-169118017 CCTCTGAACTAAGCACTTGAAGG + Intergenic
1019296046 7:276017-276039 GCTGAGAACTGAGCACTCAATGG - Intergenic
1020322427 7:6949393-6949415 CCTGAGGACTGAGGACTGTAAGG + Intergenic
1028327065 7:89540489-89540511 CCTTGGGACAGAGCACTTAGAGG + Intergenic
1037015848 8:13905161-13905183 CCTGTGGAATGATCACTGACTGG - Intergenic
1038346356 8:26735828-26735850 CCTGTAGCCTGTGCACTGAAGGG - Intergenic
1039435854 8:37558835-37558857 GCTGTGGACTGAGCACCTCATGG - Intergenic
1040900202 8:52410519-52410541 CCTGTGGAATGAGAGCTTCAAGG + Intronic
1043343858 8:79275969-79275991 CCTGTGGACTATGTGCTTAAGGG + Intergenic
1049081307 8:140445447-140445469 CCTGTGGTCTGAACTCTGAAGGG + Intronic
1051552368 9:18344517-18344539 CATGTGTATTGTGCACTTAAAGG - Intergenic
1052772638 9:32703667-32703689 CAAGTGGACAGAGTACTTAAAGG - Intergenic
1055901682 9:81246286-81246308 CCTGTGTTCTGATCACTGAATGG + Intergenic
1056689019 9:88790144-88790166 CATGTGCACTGAGCACTGCATGG + Intergenic
1058446470 9:105059532-105059554 TCTGTAGACAGAGCAGTTAAGGG - Intergenic
1060008316 9:120020179-120020201 CATGTGGAAAGAGCACTCAAGGG - Intergenic
1060477686 9:123998528-123998550 CCTGTGGGCTGGGCACTTTATGG + Intergenic
1062086862 9:134653599-134653621 CCTGTGGACCGAGCACAGTACGG - Intronic
1062186376 9:135220757-135220779 CCTGTGGACTGAGCAACCAGGGG - Intergenic
1186645105 X:11498539-11498561 CCACTGGACTGAGCACATAGTGG - Intronic
1186786327 X:12959434-12959456 AAAGTGGCCTGAGCACTTAAGGG - Intergenic
1191831296 X:65419203-65419225 CCTGTGGAATGAGGCCTAAATGG + Intronic
1195968052 X:110447264-110447286 CCTGTATACTGAGAATTTAAAGG + Intronic
1202593551 Y:26512556-26512578 CATGTGGACTGAGCTCTGGAGGG - Intergenic