ID: 1175460160

View in Genome Browser
Species Human (GRCh38)
Location 20:59146362-59146384
Sequence TGAGCACTTAAAGGTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 238}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175460151_1175460160 20 Left 1175460151 20:59146319-59146341 CCGGTTTTCGGGAGAGAGCGGCA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238
1175460154_1175460160 -5 Left 1175460154 20:59146344-59146366 CCCCACCTGCCTGTGGACTGAGC 0: 1
1: 0
2: 3
3: 15
4: 254
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238
1175460149_1175460160 23 Left 1175460149 20:59146316-59146338 CCACCGGTTTTCGGGAGAGAGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238
1175460156_1175460160 -7 Left 1175460156 20:59146346-59146368 CCACCTGCCTGTGGACTGAGCAC 0: 1
1: 0
2: 4
3: 31
4: 229
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238
1175460153_1175460160 -4 Left 1175460153 20:59146343-59146365 CCCCCACCTGCCTGTGGACTGAG 0: 1
1: 0
2: 0
3: 28
4: 288
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238
1175460157_1175460160 -10 Left 1175460157 20:59146349-59146371 CCTGCCTGTGGACTGAGCACTTA 0: 1
1: 0
2: 1
3: 7
4: 200
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238
1175460155_1175460160 -6 Left 1175460155 20:59146345-59146367 CCCACCTGCCTGTGGACTGAGCA 0: 1
1: 0
2: 1
3: 16
4: 221
Right 1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175460160 Original CRISPR TGAGCACTTAAAGGTGAGAG AGG Intergenic
900233940 1:1577650-1577672 TGAGCACTCAAAGTCCAGAGCGG - Intergenic
900494334 1:2969629-2969651 TGAGCCCCTAATGGTGAGTGTGG - Intergenic
902066367 1:13691472-13691494 TGATGACTTAAATGTGACAGAGG + Intergenic
902166321 1:14574742-14574764 TGAGCATGCAAAGGTAAGAGAGG + Intergenic
903692568 1:25184640-25184662 TGATGACTAAAAGGTGACAGAGG + Intergenic
905145098 1:35882290-35882312 TGAGACCTTTAAGGGGAGAGTGG + Intronic
905256933 1:36690897-36690919 AGAGGACTTCAAGGGGAGAGTGG - Intergenic
905467749 1:38168362-38168384 TGAGCTTTGAAAGGTGAGTGAGG + Intergenic
908570872 1:65408771-65408793 TGAGAAATTAAAGGTGAGTGAGG + Exonic
909661559 1:78089164-78089186 TGAGCATTCCACGGTGAGAGAGG + Intronic
912849848 1:113113927-113113949 TGACTACATAAAAGTGAGAGGGG - Intronic
913093973 1:115498751-115498773 TGAGCACTGAGGGGTGAGGGAGG - Intergenic
914045772 1:144090826-144090848 TGAGTACTTATAGGTGATATTGG - Intergenic
914132338 1:144869861-144869883 TGAGTACTTATAGGTGATATTGG + Intergenic
915699620 1:157779209-157779231 TCAACACTTTAAGATGAGAGAGG - Intergenic
915740510 1:158115254-158115276 TGAGCACTGAACGGAGTGAGTGG + Intergenic
918249444 1:182688627-182688649 TGAGTCCTTAAAAGTGAAAGAGG + Intergenic
919808283 1:201393873-201393895 TGAGCAAACAAAGGAGAGAGTGG + Intronic
919969195 1:202562134-202562156 TGAGCTCTTAGAGTTGATAGTGG - Intronic
921800591 1:219398663-219398685 TCAGCCCTTAAAGATGAGAAAGG - Intergenic
922116791 1:222620821-222620843 TGAGGACTAGAAGGTTAGAGAGG + Intronic
1063350794 10:5352841-5352863 TGAGAACAGAAAGGTGAGTGAGG + Intergenic
1063470318 10:6279521-6279543 TGAGCACTTAGAAGAGAGAAAGG + Intergenic
1064402880 10:15035878-15035900 TGAGCAATGAAAGGAGACAGTGG - Intronic
1066448812 10:35509612-35509634 TGAACACTTTGAGGTCAGAGAGG + Intronic
1067694695 10:48526329-48526351 TGAGGAGTTAAAGGAGAGGGAGG - Intronic
1069394061 10:67969332-67969354 GGATCACTTAAAGCTGAGTGTGG + Intronic
1070991666 10:80738866-80738888 TGGGCACATAAGGGAGAGAGGGG - Intergenic
1070992864 10:80747758-80747780 TGGGCACATAAGGGAGAGAGGGG - Intergenic
1071717351 10:88110717-88110739 GGAGCAGTTAGAGGTGAGAAGGG + Intergenic
1073554502 10:104435585-104435607 TGAGCCCGAAAAGATGAGAGAGG - Intronic
1075600141 10:123761666-123761688 TGAGCACTGGAAAGTGAGACTGG + Intronic
1076316261 10:129544143-129544165 TGGCCACATAAAGGAGAGAGGGG - Intronic
1077843605 11:6001244-6001266 TGGGGACTTCAAGGTGAGATAGG + Intergenic
1078132478 11:8624282-8624304 TCAGCACTTCTAGGTAAGAGAGG - Intronic
1078279346 11:9884350-9884372 TGATCATTTAAAGATGGGAGTGG + Intronic
1078297572 11:10089199-10089221 TGGAGACTTAAAGGTGGGAGGGG - Intronic
1079307618 11:19337565-19337587 TGAGCACTTGACGAAGAGAGAGG + Intergenic
1080174018 11:29340286-29340308 AGAGCATTTAAATTTGAGAGAGG + Intergenic
1080293826 11:30702187-30702209 TGAGCACTTAAATATGAGCAAGG - Intergenic
1081778736 11:45695146-45695168 TGGGCACATAAGGGAGAGAGGGG + Intergenic
1082039282 11:47671646-47671668 TGTGCACTGAGAGGTGGGAGGGG - Intronic
1082174591 11:49046512-49046534 TGGCCACTTAAAGGTGACTGAGG + Intergenic
1082263912 11:50099236-50099258 AGAGCACTGAATGGTGAGGGTGG + Intergenic
1085361650 11:75893369-75893391 TGAGCACGAAAAGCTGAGTGGGG + Intronic
1085380668 11:76114878-76114900 TTAGCACTTAAATTTAAGAGTGG - Intronic
1086079662 11:82890035-82890057 TGAGAACAAAAAGGTGAGAGAGG - Intronic
1086691188 11:89789576-89789598 TGGCCACTTAAAGGTGACCGAGG - Intergenic
1086714614 11:90050079-90050101 TGGCCACTTAAAGGTGACCGAGG + Intergenic
1087962002 11:104363474-104363496 TGATGCCTTAAAAGTGAGAGAGG - Intergenic
1088366258 11:109043009-109043031 TGAGAACTTCAAAGGGAGAGAGG + Intergenic
1089474839 11:118750983-118751005 GGAGCAGCTAAAGATGAGAGGGG - Exonic
1089628202 11:119765085-119765107 AGAGCACATACTGGTGAGAGGGG - Intergenic
1090007817 11:123018355-123018377 GGAGCACTTGAAGGAGAAAGTGG - Intergenic
1090173280 11:124623770-124623792 GGAACACTCAAAGGTTAGAGGGG - Intronic
1090183601 11:124721606-124721628 TGAGCACCTGGAGGTGAGAGGGG - Intergenic
1092189432 12:6507607-6507629 TGGGCACATAAGGGAGAGAGGGG + Intronic
1093893197 12:24547813-24547835 TGAGAACTTCAAGTTGATAGGGG - Intergenic
1096263486 12:50106905-50106927 TGGAGCCTTAAAGGTGAGAGGGG + Exonic
1096797743 12:54088866-54088888 TGAGCACTTTAAGGTAAGCGAGG - Intergenic
1097268257 12:57758310-57758332 AGAGCAGGTAAAGGAGAGAGAGG - Intronic
1099593559 12:84627328-84627350 TTAGGATTTAAAGGAGAGAGAGG + Intergenic
1100534530 12:95495296-95495318 AGTGCACTTATAGGAGAGAGAGG + Intronic
1102356713 12:112243124-112243146 TGAGCTCTTAATGGACAGAGTGG + Intronic
1103501679 12:121407915-121407937 TGAGCTCTTACAGTGGAGAGGGG - Intronic
1104478825 12:129089955-129089977 TTAGCACTTAAAGGGGTGTGAGG + Intronic
1105281419 13:18964875-18964897 TGTGCACTTAGAGGAGAAAGTGG - Intergenic
1105580592 13:21692210-21692232 GGAGAACCTAAAGCTGAGAGCGG - Intronic
1105740783 13:23321129-23321151 TGGGCAGTGAAAGGTGACAGTGG - Intronic
1106144562 13:27039734-27039756 TGAGGACATCAAGGGGAGAGAGG + Intergenic
1107151573 13:37117546-37117568 AAACCACTTAAAAGTGAGAGGGG - Intergenic
1107215767 13:37916758-37916780 TCAGCACTCAATGTTGAGAGAGG + Intergenic
1109287940 13:60434177-60434199 TGAGCACTTAAGGCTGGGTGTGG + Intronic
1110530497 13:76591882-76591904 TGAGAATTTAAAGGAGAAAGAGG + Intergenic
1111923399 13:94436526-94436548 TGAGGACTTAGAGGAGAGATGGG + Intergenic
1112340368 13:98547977-98547999 TGAGTTCTTAAGGGAGAGAGGGG - Intronic
1113076138 13:106469705-106469727 TGATCACTTGAAGGGAAGAGCGG + Intergenic
1119708316 14:76801611-76801633 TGAGAAGTTAAAGGTTAGAAAGG - Intronic
1119937874 14:78609546-78609568 TGAGCTCTGAAAGATGTGAGTGG + Intronic
1120346019 14:83291311-83291333 AGAGCACATAAAGGTCAGTGTGG + Intergenic
1120595903 14:86435282-86435304 TGGTAACTTAAAGGTAAGAGAGG - Intergenic
1123128344 14:105965864-105965886 TGTGGACTTAAAGGTAGGAGGGG - Intergenic
1123899171 15:24859019-24859041 TGGGCACATAAGGGAGAGAGGGG - Intronic
1123987174 15:25656243-25656265 TGGGAACTTCAAGGGGAGAGGGG + Intergenic
1125094966 15:35840069-35840091 TGAGGACTGAGAGGTTAGAGAGG - Intergenic
1125553579 15:40566001-40566023 AGAGTACATAAAGGAGAGAGTGG + Intergenic
1127796984 15:62447251-62447273 TTAGGAGTTTAAGGTGAGAGAGG + Intronic
1128920688 15:71607453-71607475 TGAGGATTCAAAGGTGAGAAAGG + Intronic
1129702061 15:77773870-77773892 TCAGGACTTAAGGGAGAGAGTGG - Intronic
1131640719 15:94289911-94289933 TGAGCCCTTAAAAGTGGAAGAGG + Intronic
1132173959 15:99692994-99693016 GGATGACTTAAAGCTGAGAGTGG + Intronic
1140727635 16:77828358-77828380 AGAGTCCTTAAAGGTGGGAGTGG + Intronic
1141170907 16:81691059-81691081 TGATCACAGAAAGGTGAGAATGG + Intronic
1141359417 16:83381626-83381648 TGAGCTTTTTTAGGTGAGAGTGG - Intronic
1141438931 16:84016813-84016835 GGAGCACTGACAGGTGTGAGGGG - Intronic
1141598356 16:85111004-85111026 GGAGCCCTTAAAGGTGAGTTGGG - Intronic
1144123943 17:12183493-12183515 TGAGCACAGAAAGGTGTGGGAGG - Intergenic
1144524934 17:15981317-15981339 TGAGCACTGAGAGGTGAGGAAGG - Intronic
1144866808 17:18340926-18340948 TGAGGACTTGAGGGTGAGACAGG + Intronic
1147660988 17:42117025-42117047 TGAGCAGGTCAAGGTGAGCGCGG - Exonic
1147880273 17:43648948-43648970 TTAGCACTCATAGGTGAGTGAGG + Intronic
1148872972 17:50669254-50669276 AGTGCACATGAAGGTGAGAGAGG + Exonic
1151266829 17:72962989-72963011 TGAGCCCTTAAAAGAGAGAGTGG - Intronic
1153912122 18:9713586-9713608 TGAGCTCTGAAAGCTGAGGGAGG - Intronic
1156649692 18:39210797-39210819 TGAGAGATAAAAGGTGAGAGTGG - Intergenic
1157359750 18:46965850-46965872 TTTGGACTGAAAGGTGAGAGTGG - Intronic
1157361339 18:47025367-47025389 TTTGGACTGAAAGGTGAGAGTGG - Intronic
1160237251 18:77095709-77095731 TGAGCACATAAATGTGAAGGGGG - Intronic
1163702414 19:18792703-18792725 TGAGTACTGGAAGGTGGGAGTGG - Intergenic
1165378976 19:35464396-35464418 TGGGCACGTAAGGGAGAGAGGGG + Intergenic
1165825684 19:38704577-38704599 AGAGCACTGAGAGTTGAGAGAGG + Intronic
1166077720 19:40423393-40423415 TGAGCACTGAGAGGTCAAAGAGG + Exonic
1168104990 19:54161075-54161097 TGAACACTGAATGGGGAGAGAGG + Intronic
1168378588 19:55901390-55901412 TGGGCACTTAAGGGAGAGAAGGG + Intronic
1202685330 1_KI270712v1_random:44237-44259 TGAGTACTTATAGGTGATATTGG - Intergenic
925295915 2:2777265-2777287 TGTGCATTTAAAGCTGAGTGAGG + Intergenic
927944804 2:27129252-27129274 TGAATACTGAAAGGGGAGAGGGG + Intronic
928489373 2:31765585-31765607 TCAGTAGATAAAGGTGAGAGTGG - Intergenic
928960771 2:36923809-36923831 TGAGTACTTATAGGTGATATTGG - Intronic
929651513 2:43684360-43684382 TGGGCAGTTAAAGGAGAGAAAGG - Intronic
929856412 2:45642071-45642093 GGAGCATTTCAAGGCGAGAGGGG + Intergenic
930722784 2:54653952-54653974 TGAGCGCTTCAAGGCCAGAGTGG + Intronic
930842758 2:55865594-55865616 TGGGCTCTTAAAGGTTAAAGGGG - Intergenic
931504130 2:62905230-62905252 TGAGATCTAAAAGGTGAGAATGG + Intronic
931874629 2:66498498-66498520 TGAGGAGATAAAGGGGAGAGAGG + Intronic
933543974 2:83685958-83685980 TGAGCACTTGAAGGTAAGCTAGG - Intergenic
934246395 2:90310595-90310617 TGAGTACTTATAGGTGATATTGG + Intergenic
935816128 2:106847634-106847656 TGAACAGTTAAAAGTGTGAGTGG - Intronic
936251484 2:110871453-110871475 GAAGCACTTAAAACTGAGAGAGG + Intronic
937254356 2:120544623-120544645 GGAACACTTAAAAGAGAGAGAGG + Intergenic
937955142 2:127417926-127417948 TGAGCAATTGGAGGTGAGGGTGG + Intergenic
938990666 2:136625862-136625884 AGAGCTGTTAATGGTGAGAGAGG + Intergenic
942547891 2:177083704-177083726 GGAGCAATTAAAGCTCAGAGAGG + Intergenic
942576354 2:177367791-177367813 TACACACTTAAAGGGGAGAGAGG - Intronic
943492318 2:188570465-188570487 TGAGCACTTCAAGGGGAGACTGG - Intronic
944424816 2:199569215-199569237 TGAGCATTTAAATGTGAGCCAGG - Intergenic
944740932 2:202611826-202611848 TGAGCACTTCAAGTTCAGAATGG - Intergenic
944903030 2:204235097-204235119 TGAGCACTTGAAGGGAAGACTGG + Intergenic
946572760 2:221042702-221042724 TGAGGACTCACAGGGGAGAGGGG - Intergenic
947714272 2:232331991-232332013 AGAGCACAGAAAGGTGTGAGGGG + Intronic
947733479 2:232443370-232443392 AGAGCACAGAAAGGTGTGAGGGG + Intergenic
948090196 2:235287035-235287057 TGAGTCCTTAAAAGTGGGAGAGG - Intergenic
948345816 2:237297195-237297217 TGGGCCCTTAAAGGTGGGAGAGG - Intergenic
948709121 2:239814341-239814363 TGAGCAGTTGATGGTGACAGGGG + Intergenic
948736662 2:240012476-240012498 TCAACACTTACAGGAGAGAGAGG + Intronic
1171849585 20:30298723-30298745 TGAACACTTTAAGGTAAGCGAGG - Intergenic
1174078181 20:47952679-47952701 AGAGCCCTGAAAGGTGAGAAGGG - Intergenic
1175460160 20:59146362-59146384 TGAGCACTTAAAGGTGAGAGAGG + Intergenic
1179294868 21:40052791-40052813 TGGGCACTTGAAGGTGAGCGAGG + Intronic
1181086757 22:20443433-20443455 TGAGCCCTTAAAAGTGGAAGGGG + Intronic
1182038091 22:27215052-27215074 TGAGCAAGTAGAGGTCAGAGAGG - Intergenic
1184282737 22:43447671-43447693 TGAGCACTGAAGTGTGAGATAGG - Intronic
949356810 3:3189754-3189776 TGAGCATATAAAGATGAGTGAGG - Intergenic
949875433 3:8623439-8623461 TGAGGACGTAGAGGTGAGGGAGG - Intronic
950884787 3:16353744-16353766 TGAGCACGCACAGGTGGGAGGGG - Intronic
951115469 3:18856099-18856121 TGAGTATTTAGAGATGAGAGAGG + Intergenic
952763100 3:36933157-36933179 TGGGCACATAAGGGAGAGAGGGG - Intronic
953227673 3:41035332-41035354 TGACAGCTTAAAGGTGAAAGAGG - Intergenic
953232852 3:41079926-41079948 TCAGCACTTGTAGGTAAGAGGGG + Intergenic
954274857 3:49535486-49535508 TGAACACTTGAATGTGAGATTGG - Exonic
954716448 3:52529140-52529162 CGAGCACTACAAGGTGAGACGGG - Exonic
958433726 3:94072561-94072583 TGAGAACAGATAGGTGAGAGAGG + Intronic
960373841 3:116874247-116874269 GGAGCACTTCAAGGTGAAATGGG + Intronic
962973135 3:140423810-140423832 TGGGCACGTAAGGGAGAGAGGGG - Intronic
962981158 3:140491329-140491351 TGAGCACTTAAATGTTTCAGTGG + Intronic
964175147 3:153819002-153819024 TGAGCAGTGAAAGGTGAGACGGG + Intergenic
964333914 3:155634518-155634540 TGAGCACTTACAGGACAGTGGGG + Intronic
966561628 3:181326897-181326919 TAAGAACTTGAAGCTGAGAGTGG - Intergenic
967858751 3:194136476-194136498 TGAGCACAGAAAGGTAAGGGCGG + Exonic
968187069 3:196640092-196640114 GGAGCACTTAGAGCTGAGAAAGG + Intronic
969444386 4:7235749-7235771 TGAGCACTTAGTGGGCAGAGAGG + Intronic
973296029 4:48521788-48521810 TGAACACTTAAATGGGAGAGGGG + Intronic
974212981 4:58806613-58806635 TTAGAACTAAAAGGTAAGAGAGG - Intergenic
974888720 4:67852306-67852328 TGAGCACTGAAAGCTTTGAGTGG + Intronic
975197359 4:71541399-71541421 GGAGCACTGAAAGGAGAGAATGG + Intronic
975605683 4:76151907-76151929 TGAGAACTTACAGTTGAGTGAGG + Intergenic
976494834 4:85715813-85715835 AGAGAACATAAAGGTGAGAAAGG - Intronic
977916364 4:102598780-102598802 TGAGCACATACAGGTTAGAAAGG + Intronic
978310288 4:107379756-107379778 TGGGCACGTAAGGGAGAGAGGGG - Intergenic
978311427 4:107388284-107388306 TGGGCACGTAAGGGAGAGAGGGG - Intergenic
982927877 4:161362598-161362620 TAACCACTTAAACCTGAGAGAGG + Intergenic
987900188 5:24000939-24000961 TGATTTCTTAAAGGTGAAAGTGG - Intronic
988269809 5:28999416-28999438 TTAGCCCCTAAAGGTGATAGGGG + Intergenic
992576288 5:78117032-78117054 TGAGCAGCAAGAGGTGAGAGAGG - Intronic
993603250 5:89955010-89955032 TGTGCACATGAGGGTGAGAGGGG - Intergenic
999578253 5:153005082-153005104 TCAGAACTTCAAGGTGATAGGGG - Intergenic
1000397472 5:160790878-160790900 TGAGTCCTTTAAGGTGAAAGAGG + Intronic
1001948418 5:175798621-175798643 TGTGGACTGAAAGATGAGAGTGG + Intronic
1002160113 5:177310001-177310023 GGAGGCCTTGAAGGTGAGAGGGG + Intronic
1002876178 6:1211738-1211760 TCAGCACTTAAAGGGGGGGGTGG + Intergenic
1007249246 6:40484449-40484471 TGTGCACATTATGGTGAGAGAGG - Intronic
1008663958 6:53697528-53697550 TGAGCACTTAAGGCAGAGAAAGG + Intergenic
1009302536 6:62044169-62044191 TGAGCACTTAAGCGGGAGACTGG - Intronic
1009378360 6:62999386-62999408 TGGGCACGTAAGGGAGAGAGAGG + Intergenic
1009714879 6:67378390-67378412 TGAGAACTTAAATGAGAGAAGGG + Intergenic
1009933980 6:70210976-70210998 TGATCACTAAAATATGAGAGTGG - Intergenic
1011134277 6:84082964-84082986 TGGGCACGTAAGGGAGAGAGGGG - Intronic
1011553254 6:88548888-88548910 TGAGTACTTCCAGGTGATAGTGG - Intergenic
1014126055 6:117778215-117778237 TGGGCAATAAAAGATGAGAGTGG - Intergenic
1014308700 6:119771745-119771767 TGGGCAGGTAAAGGAGAGAGGGG + Intergenic
1017245881 6:152223844-152223866 AGAGCAGTGACAGGTGAGAGTGG + Intronic
1017421534 6:154277912-154277934 TGAGCATGTAAAGATGAGAGTGG - Intronic
1018265089 6:162015607-162015629 TGAGCAGTGGAAGGTGACAGGGG - Intronic
1019956327 7:4417500-4417522 TGAGCTCAGAAAGGTGAGTGAGG - Intergenic
1020669003 7:11083040-11083062 TGTGCACATAAGGGAGAGAGGGG - Intronic
1021212464 7:17871542-17871564 TGAGGAATTTAAGGTGAGGGAGG - Intronic
1022053226 7:26700999-26701021 TGAGAACACAAAGGGGAGAGAGG - Intronic
1023578371 7:41654222-41654244 TGAGCACATGAAGGGGACAGTGG + Intergenic
1023896615 7:44439099-44439121 TGAGCACTGAGCAGTGAGAGCGG + Intronic
1025186012 7:56859164-56859186 AGAGCACTGAATGGTGAGGGTGG + Intergenic
1025685914 7:63717769-63717791 AGAGCACTGAATGGTGAGGGTGG - Intergenic
1025908234 7:65806325-65806347 AGAGCACTGAATGGTGAGAGTGG - Intergenic
1025980846 7:66404423-66404445 AGAGCACTGAATGGTGAGAGTGG + Intronic
1027419215 7:78003607-78003629 TGAGCATTTTAAGGTAAGCGAGG + Intergenic
1030694784 7:112572947-112572969 TGATCACTTTCAGGTGAGACTGG - Intergenic
1031961329 7:127992792-127992814 TGATCACTAAAAGGAGTGAGTGG + Intronic
1032527140 7:132587141-132587163 TGAGCACATTCAGGAGAGAGTGG + Intronic
1033359661 7:140629621-140629643 TGGACACATTAAGGTGAGAGTGG + Intronic
1034293840 7:149953696-149953718 TGAGTCCTGAAAGGAGAGAGAGG - Intergenic
1034687957 7:152990138-152990160 TGAGCACGTAAGGGAGAGAGGGG - Intergenic
1034812229 7:154143163-154143185 TGAGTCCTGAAAGGAGAGAGAGG + Intronic
1036429319 8:8675173-8675195 TGAGCTCTAAATGATGAGAGAGG + Intergenic
1037015776 8:13904391-13904413 ACAGAACTTACAGGTGAGAGAGG - Intergenic
1040103242 8:43523388-43523410 TGGGCACATAAGGGAGAGAGGGG + Intergenic
1040588802 8:48770084-48770106 TAAGCACTTAAATGTGAATGTGG - Intergenic
1042217155 8:66438319-66438341 TGAGCTCTAAAGGGTGAGGGAGG + Intronic
1043354868 8:79400596-79400618 TGAGCTCTCCAAGGAGAGAGAGG - Intergenic
1045323397 8:101098777-101098799 TGAGCACCACAAGGCGAGAGAGG - Intergenic
1045332745 8:101169867-101169889 TGAGCACTGAAAGTGGAAAGAGG + Intergenic
1046344750 8:112908379-112908401 TTAGCACTTGAAAGTAAGAGTGG + Intronic
1046694964 8:117329808-117329830 TGAGCAGTTTCAGGAGAGAGGGG - Intergenic
1048510253 8:135055515-135055537 TGATCACTTACAGGAGAGAGAGG - Intergenic
1048591957 8:135828593-135828615 TGAGCACTTAAAGATGCCATAGG + Intergenic
1049311737 8:141937218-141937240 TGAGTCCTTAAAGGAGAAAGAGG + Intergenic
1051244276 9:15093340-15093362 TGAGCCCTTAAAAGTGGAAGAGG - Intergenic
1051263723 9:15290792-15290814 TCAACATTTAAAGGGGAGAGTGG - Intronic
1051585967 9:18727329-18727351 TAAGCACTTAAAAGTTAGTGTGG - Intronic
1052044926 9:23782979-23783001 TGAGCTCTCAAATGGGAGAGGGG - Intronic
1053787363 9:41662017-41662039 TGAGCACTTTAAGGTAAGCGAGG - Intergenic
1054157764 9:61652750-61652772 TGAGCACTTTAAGGTAAGCGAGG + Intergenic
1054175640 9:61873356-61873378 TGAGCACTTTAAGGTAAGCGAGG - Intergenic
1054477538 9:65583755-65583777 TGAGCACTTTAAGGTAAGCGAGG + Intergenic
1054661899 9:67707454-67707476 TGAGCACTTTAAGGTAAGCGAGG + Intergenic
1054899254 9:70350727-70350749 TCAGCACTGAAAGATGAGTGGGG + Intronic
1057203650 9:93157610-93157632 TGTTCACTGAAATGTGAGAGTGG - Intergenic
1058189191 9:101892222-101892244 TGGACACTTCAAGGTGAGACAGG - Intergenic
1058307434 9:103460929-103460951 TGAGCACATAAGGGAGAGAGGGG - Intergenic
1058982366 9:110181954-110181976 TGGCCACTTACAGGTGACAGTGG - Intergenic
1059433813 9:114264890-114264912 AGAGCACGTGAAGGTGGGAGAGG - Intronic
1059508431 9:114820733-114820755 TGAGAAAATTAAGGTGAGAGAGG - Intergenic
1060163850 9:121392337-121392359 TGAGCACCTAATGGAGAAAGGGG + Intergenic
1060321497 9:122565514-122565536 TGGGCACTCAAAGGTGGCAGTGG - Intergenic
1060678885 9:125543693-125543715 TGAGCAGTTCCATGTGAGAGAGG + Intronic
1193882721 X:86944013-86944035 TGAGCATTTAAAAATGATAGGGG + Intergenic
1197874851 X:131091754-131091776 TAAGAAGTTAAAGGTCAGAGAGG - Intergenic
1198431129 X:136567295-136567317 TGAGGAGTTAAAGGTGTGAGGGG - Intergenic
1198729368 X:139711823-139711845 AGAGCACTTAATGCTGAGAATGG + Intergenic
1198934805 X:141895004-141895026 TGGGCAATAAAAGGTGAAAGGGG + Intronic
1199953715 X:152725750-152725772 TGAGCAGTGGAAGGTGAGGGTGG + Intergenic
1200818515 Y:7557867-7557889 TGAGCCCCAAGAGGTGAGAGGGG - Intergenic
1201454032 Y:14148596-14148618 TGGGCACATAAAGGAGAGAGGGG - Intergenic
1201643815 Y:16205551-16205573 TGGGCACATAAAGGAGAGAGGGG - Intergenic
1201659000 Y:16379770-16379792 TGGGCACATAAAGGAGAGAGGGG + Intergenic
1202588299 Y:26455381-26455403 TGAGTACTTATAGGTGATATTGG + Intergenic