ID: 1175460313

View in Genome Browser
Species Human (GRCh38)
Location 20:59147433-59147455
Sequence GGATACACCCAGAGGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175460313_1175460317 -4 Left 1175460313 20:59147433-59147455 CCTTGTCCCCTCTGGGTGTATCC No data
Right 1175460317 20:59147452-59147474 ATCCGTTAATCTCCTCACTCTGG No data
1175460313_1175460319 3 Left 1175460313 20:59147433-59147455 CCTTGTCCCCTCTGGGTGTATCC No data
Right 1175460319 20:59147459-59147481 AATCTCCTCACTCTGGCCCTTGG No data
1175460313_1175460322 18 Left 1175460313 20:59147433-59147455 CCTTGTCCCCTCTGGGTGTATCC No data
Right 1175460322 20:59147474-59147496 GCCCTTGGATGTCTGGCCAGTGG No data
1175460313_1175460321 11 Left 1175460313 20:59147433-59147455 CCTTGTCCCCTCTGGGTGTATCC No data
Right 1175460321 20:59147467-59147489 CACTCTGGCCCTTGGATGTCTGG No data
1175460313_1175460326 25 Left 1175460313 20:59147433-59147455 CCTTGTCCCCTCTGGGTGTATCC No data
Right 1175460326 20:59147481-59147503 GATGTCTGGCCAGTGGCCAAGGG No data
1175460313_1175460325 24 Left 1175460313 20:59147433-59147455 CCTTGTCCCCTCTGGGTGTATCC No data
Right 1175460325 20:59147480-59147502 GGATGTCTGGCCAGTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175460313 Original CRISPR GGATACACCCAGAGGGGACA AGG (reversed) Intergenic
No off target data available for this crispr