ID: 1175465867

View in Genome Browser
Species Human (GRCh38)
Location 20:59191168-59191190
Sequence GGCCTTCAGGAACACAGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175465867_1175465882 15 Left 1175465867 20:59191168-59191190 CCCCCACTGTGTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 22
4: 240
Right 1175465882 20:59191206-59191228 TACCACACGGTGCCTCCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
1175465867_1175465880 13 Left 1175465867 20:59191168-59191190 CCCCCACTGTGTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 22
4: 240
Right 1175465880 20:59191204-59191226 TGTACCACACGGTGCCTCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 84
1175465867_1175465879 12 Left 1175465867 20:59191168-59191190 CCCCCACTGTGTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 22
4: 240
Right 1175465879 20:59191203-59191225 CTGTACCACACGGTGCCTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 103
1175465867_1175465881 14 Left 1175465867 20:59191168-59191190 CCCCCACTGTGTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 22
4: 240
Right 1175465881 20:59191205-59191227 GTACCACACGGTGCCTCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1175465867_1175465874 2 Left 1175465867 20:59191168-59191190 CCCCCACTGTGTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 22
4: 240
Right 1175465874 20:59191193-59191215 GCCCATCCCACTGTACCACACGG 0: 1
1: 0
2: 0
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175465867 Original CRISPR GGCCTTCAGGAACACAGTGG GGG (reversed) Exonic
900616597 1:3568323-3568345 GGCCTCCAGGAACACGGCAGGGG + Intronic
900986400 1:6075392-6075414 CTCCATCAGGAACACAGTGATGG + Intronic
901084767 1:6603514-6603536 CTCCTTCAGGAACACAGGAGTGG - Intronic
901941525 1:12666017-12666039 GGCCTTCAGGAAGTGAATGGAGG - Exonic
902636007 1:17735574-17735596 GGGCTGCAGGAACCCAGGGGAGG - Intergenic
902691103 1:18110498-18110520 GGCCTTCACGAACGTACTGGCGG + Intronic
904355579 1:29936887-29936909 GGCCCTAAGGGACACAGTGAAGG - Intergenic
906099638 1:43250991-43251013 GGCAATCAGGAACAAAGTTGGGG + Intronic
906199658 1:43951332-43951354 GGCCTTGAAGAACCCAGAGGAGG + Intronic
906288754 1:44605660-44605682 AGGCTTCGGGAACACAGAGGAGG + Intronic
906639149 1:47431219-47431241 GAGCTTCAGGAACACAGAGGTGG + Intergenic
907305700 1:53511871-53511893 GGGCTTCAGGAAACCAGGGGAGG - Intronic
907498736 1:54862668-54862690 GGACTTCAGGAGTTCAGTGGAGG - Intronic
911965785 1:104369036-104369058 TACATTCTGGAACACAGTGGGGG - Intergenic
913250068 1:116906016-116906038 CGCCTGCAGGAACACTGGGGTGG - Intergenic
913490056 1:119370740-119370762 GGCCTTCAGAAACACAGTCTGGG + Intronic
915781996 1:158562686-158562708 GGCCTTCAGGAAGACAGTGATGG - Exonic
916847172 1:168663514-168663536 GGAGTTCAGGACCTCAGTGGAGG + Intergenic
920837607 1:209526196-209526218 GGGCTGCAGGAGCACAGAGGAGG - Intergenic
921217165 1:212947737-212947759 GGACTTTGGGAACTCAGTGGTGG - Intergenic
921301849 1:213758685-213758707 GGAGTTCAGGACCTCAGTGGAGG + Intergenic
921311940 1:213853226-213853248 GGCCTTCAGCCACATGGTGGAGG + Intergenic
921880653 1:220250870-220250892 GGCCTCAGGAAACACAGTGGTGG - Intronic
922651385 1:227342053-227342075 GGCCTTCAGCCACAGACTGGAGG - Intergenic
922703347 1:227775114-227775136 GGCCTCCAGGAATGCAGCGGAGG + Intronic
923855551 1:237841484-237841506 GACATTCAGGAACACAGCAGTGG + Intergenic
923941934 1:238837482-238837504 GGCCTTCAGGAAGGCAGTTAAGG + Intergenic
924946864 1:248852401-248852423 GGTCTTGAGGGGCACAGTGGAGG - Intronic
1063149274 10:3321936-3321958 GGCCTTCAGCAACAGACTGAAGG + Intergenic
1067685912 10:48466055-48466077 GGCCTGGAGGAGCACAGTAGAGG + Intronic
1067965688 10:50910206-50910228 GGCCTTGAGGCCCACAGTGTGGG + Intergenic
1069789467 10:71010483-71010505 GACCTTCAGAGACACAGTGCAGG + Intergenic
1070556131 10:77529208-77529230 GGAGGGCAGGAACACAGTGGGGG - Intronic
1070823847 10:79379708-79379730 GAGCTTCAGCACCACAGTGGGGG + Intergenic
1071266398 10:83968483-83968505 GTCCTTCATCCACACAGTGGAGG + Intergenic
1071784946 10:88888518-88888540 GACCTTTAGGAACACAGAGTTGG - Intronic
1072960347 10:99923676-99923698 GGTGGTGAGGAACACAGTGGAGG - Intronic
1073335581 10:102705770-102705792 GGGCTTTAGGAACACAGATGGGG - Intronic
1074428412 10:113372217-113372239 GGATTTGAGGTACACAGTGGGGG - Intergenic
1075261250 10:120965409-120965431 GGCCTTCATGAAAACACTGCTGG - Intergenic
1075799326 10:125143061-125143083 GGAGTTCAGCAAAACAGTGGTGG - Intronic
1076978829 11:194620-194642 GGACATCAGGAACACACTCGGGG + Intronic
1077178308 11:1200543-1200565 GGCCTTCAGCTACACCGAGGTGG + Intronic
1078335890 11:10462881-10462903 GGCCTTCTGGAAGAAACTGGGGG - Intronic
1080686775 11:34522507-34522529 GGCCTTCAGCTTCACTGTGGGGG + Intergenic
1081574643 11:44311332-44311354 GGCCTTGAGGCTCGCAGTGGTGG - Intergenic
1083734097 11:64669858-64669880 GGCCTGCAGAAGCACAGTGTTGG - Intronic
1083888723 11:65585279-65585301 GGCCTCCAGGAACGCGGTCGCGG + Exonic
1084694173 11:70744085-70744107 GGCCTGCAGCCACACATTGGTGG - Intronic
1086940333 11:92790934-92790956 GTCTTAAAGGAACACAGTGGGGG - Intronic
1087639616 11:100742367-100742389 TTCCTTGAGGAACACAGTGCAGG + Intronic
1088714241 11:112534920-112534942 GGCCCTCAGGAACATATTCGAGG + Intergenic
1089538450 11:119174850-119174872 GGCCATCAGGGACAAATTGGAGG - Exonic
1090028146 11:123185132-123185154 GGTCTTCAAGAACAGGGTGGGGG + Intronic
1090737961 11:129628301-129628323 GGGCTTCAGGAGTTCAGTGGAGG - Intergenic
1090870194 11:130737697-130737719 CGCCTGCAGAGACACAGTGGGGG + Intergenic
1091116147 11:133015559-133015581 GGCCTTCAGGCACACAGAATTGG - Intronic
1091534330 12:1391404-1391426 GGCCTCCACTAACACAGTGGGGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1091790291 12:3268292-3268314 AGGCTGCAGGAACACAGAGGGGG - Intronic
1092010179 12:5103456-5103478 AGCCTTCAGGAACTCAATAGGGG - Intergenic
1092456146 12:8644715-8644737 AGACATCAGGAGCACAGTGGAGG - Intronic
1095754496 12:45748934-45748956 GGGCTTCAAGATTACAGTGGAGG - Intronic
1096976622 12:55703023-55703045 GCCCTGCATGAACAGAGTGGGGG - Intronic
1098831568 12:75371183-75371205 GGCCTTCAGCCACACACTGAAGG - Intronic
1100266591 12:92982489-92982511 GGCCTTCAGCCACAGAGTGAGGG + Intergenic
1101305551 12:103524367-103524389 TGCCTTGAGGCACACAGAGGTGG + Intergenic
1101875105 12:108592288-108592310 GGCCTTCAGGGGCACAGAGCGGG + Exonic
1102212953 12:111140118-111140140 GTCTTTAAGGAACACAGTGAGGG - Intronic
1104224144 12:126814529-126814551 GATCTCCAGGAAGACAGTGGAGG + Intergenic
1105513511 13:21071292-21071314 AGCCTTCAGAAAGACATTGGTGG + Intergenic
1106534099 13:30623746-30623768 GGCCTCCAGGAAAGGAGTGGAGG + Intronic
1108383306 13:49874850-49874872 GGCAATCAGGAACACAGTTGGGG - Intergenic
1109175057 13:59144880-59144902 GGCCTTCTGAAACACATTGCTGG - Intergenic
1111456313 13:88488504-88488526 GGCAATCAGGAACACAGCTGGGG - Intergenic
1112325536 13:98440815-98440837 GGACTTCAGCATCGCAGTGGAGG + Exonic
1114021810 14:18486606-18486628 AGGATTCAAGAACACAGTGGCGG + Intergenic
1114642416 14:24232405-24232427 GCCTTTCCGGAACCCAGTGGGGG - Exonic
1114788454 14:25628172-25628194 AACATTCAGGAAAACAGTGGAGG + Intergenic
1118001150 14:61525109-61525131 AGCCTTCTGGAATACAGTGCGGG + Intronic
1118952706 14:70449160-70449182 GTCCTTCATGAATACATTGGTGG - Intergenic
1120722701 14:87905645-87905667 GGCCCTCGGGAACACATTTGTGG + Intronic
1121139072 14:91524941-91524963 GGCCTTCAGGATCACATCTGAGG + Intergenic
1122342278 14:101036146-101036168 GAAGTTCAGGAACACAGTGTGGG + Intergenic
1123104393 14:105831564-105831586 GGCCTTGGGAAACACAGTCGTGG + Intergenic
1123494606 15:20813522-20813544 GGCATTCCTGCACACAGTGGTGG - Intergenic
1123551101 15:21382615-21382637 GGCATTCCTGCACACAGTGGTGG - Intergenic
1124615506 15:31239016-31239038 GGCCTTAAGGGACAGAGTTGAGG + Intergenic
1124623801 15:31296862-31296884 GCCTTTCAGGTACACATTGGCGG + Intergenic
1125109100 15:36010097-36010119 GGACTTCAAGAATTCAGTGGAGG - Intergenic
1127833113 15:62768182-62768204 GAACTTCATGAACACAGTTGGGG - Intronic
1127875357 15:63107048-63107070 GGCCTCCCAGCACACAGTGGGGG - Intergenic
1127976107 15:63998456-63998478 AGCCTGCAGGAACAGTGTGGTGG - Intronic
1129743153 15:77999980-78000002 GGCCTTCAGAAACACAGGGAGGG - Intronic
1129842329 15:78751460-78751482 GGCCTTCAGAAACACAGGGAGGG + Intergenic
1129960005 15:79675593-79675615 AGAGTTCAGGAACACAGTGCTGG - Intergenic
1202959443 15_KI270727v1_random:109858-109880 GGCATTCCTGCACACAGTGGTGG - Intergenic
1133711145 16:8402182-8402204 GGCCTGCAGCAGGACAGTGGTGG + Intergenic
1134771876 16:16816147-16816169 GGCATTCAGGGACCCAGTTGTGG + Intergenic
1134787511 16:16958468-16958490 GTACTTCAGGAACAAGGTGGTGG + Intergenic
1135380527 16:21992699-21992721 GGCCTTCAGCCACAGACTGGAGG + Intronic
1138287533 16:55821571-55821593 GACCTTCAGGACCACAGATGGGG + Intronic
1140055428 16:71521567-71521589 GGCCTCCAGGAAGATAGTGGTGG - Intronic
1141631989 16:85293044-85293066 GGTGTTCAGCAACACGGTGGCGG - Intergenic
1142466257 17:139112-139134 GGACATCAGGAACACACTCGAGG + Intergenic
1142466355 17:139651-139673 GGACATCAGGAACACACTCGGGG + Intergenic
1148471702 17:47897585-47897607 GGCATTCAGTTTCACAGTGGAGG + Intronic
1150282444 17:63937198-63937220 GGACTTTGGGAACTCAGTGGGGG + Intergenic
1150509489 17:65735112-65735134 GGCTGTCAGGCTCACAGTGGTGG + Intronic
1150610253 17:66727781-66727803 GGTCTTCAGGAAGACAGAGGAGG + Intronic
1152459976 17:80437392-80437414 GGGTTTCAGGAGGACAGTGGGGG + Exonic
1152822082 17:82442502-82442524 GGCCCTCAGGAACTGAGTGTGGG - Exonic
1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG + Intronic
1153515730 18:5899231-5899253 GGCTATCAGGTACACTGTGGTGG - Intergenic
1154452004 18:14486039-14486061 GGCATTCCCGCACACAGTGGTGG - Intergenic
1157567434 18:48689088-48689110 GGCCTTCAGACACACCCTGGAGG + Intronic
1159531394 18:69660147-69660169 GGCCTTCAGGAAGAAAGTCGGGG - Intronic
1161238890 19:3210997-3211019 GCACTCCAGGAACACAGCGGTGG - Intergenic
1163492973 19:17627796-17627818 GGCCTGCAGGGACACAGTGGTGG + Intronic
1166652974 19:44589016-44589038 GGCCTTCTGGGACACAGAGGAGG + Intergenic
1167108675 19:47446304-47446326 AGGCTTCAGGCACACATTGGGGG + Intronic
1168321342 19:55511833-55511855 GGCCTCCAGGATCAGTGTGGGGG + Intronic
925101570 2:1251044-1251066 GGCCTTCAGAACCACAATGATGG - Intronic
925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG + Intergenic
926357508 2:12055037-12055059 GGGCTTCAGGGATACAGTGATGG + Intergenic
927792493 2:26021106-26021128 GGCCTTCAAGGACACAGGGCAGG + Intergenic
929565370 2:42980467-42980489 TGCCTACAGAAACACAGTGATGG + Intergenic
932667131 2:73707156-73707178 GTCCTTCAGGAACACAGTCCTGG - Intergenic
932669794 2:73727674-73727696 GTCCTTCAGGAACACAGTCCTGG - Intergenic
932740556 2:74287621-74287643 AGCCTTGAGGGACACAGTGAGGG - Intronic
933722968 2:85409966-85409988 GGCCTTCAGGAGCAGTGTGGTGG + Intronic
933916242 2:86996824-86996846 GGACTTCAGGAACAGCGTAGGGG + Intronic
934006751 2:87773078-87773100 GGACTTCAGGAACAGCGTAGGGG - Intronic
935559817 2:104548466-104548488 GGGTTTCAGGATCAGAGTGGGGG - Intergenic
935770401 2:106414001-106414023 GGACTTCAGGAACAGCGTAGGGG - Intronic
935909688 2:107881934-107881956 GGACTTCAGGAACAGCGTAGGGG + Intronic
935967810 2:108498817-108498839 GGACTTCAGGAACAGGGTAGGGG + Intronic
938550774 2:132380207-132380229 GGCAATCAGGAATACAGTTGGGG + Intergenic
941685460 2:168443605-168443627 TGCCTACAGGATCTCAGTGGGGG - Intergenic
941932497 2:170956075-170956097 GGAATTCAGGAAAGCAGTGGTGG + Intronic
943365769 2:186966361-186966383 GGGCTTCAGGAAGACCCTGGAGG + Intergenic
944619862 2:201503362-201503384 GGACTTCAGGCACACATTGCTGG + Intronic
945710157 2:213284764-213284786 GGCTCTCAGGAAGACTGTGGTGG - Intronic
945756513 2:213854031-213854053 GGATTTCAGGAACACACTGAGGG - Intronic
946234883 2:218318028-218318050 GGCATTCAGGAAATCACTGGTGG - Intronic
946482326 2:220069047-220069069 ATCCTCCAGGAACTCAGTGGTGG + Intergenic
947924099 2:233905833-233905855 CTCCTTCAGGAACATGGTGGAGG + Intergenic
1171431247 20:25084340-25084362 GGCCTGCAGGACCCCAGCGGTGG + Intergenic
1171447206 20:25213330-25213352 GGCCTTGAGGACCAGAGGGGTGG - Exonic
1171970199 20:31559700-31559722 GGCCTTCAGGAGCCCAGAGAAGG + Intronic
1175465867 20:59191168-59191190 GGCCTTCAGGAACACAGTGGGGG - Exonic
1176389862 21:6157948-6157970 GGCCTTCTGGAAGGCGGTGGGGG - Intergenic
1176822188 21:13667300-13667322 GGCATTCCCGCACACAGTGGTGG + Intergenic
1177879123 21:26670841-26670863 AGCAATCAGGAACACAGTTGGGG + Intergenic
1178919027 21:36726348-36726370 GGCCTTCTGGAAGACACCGGTGG + Intronic
1179733605 21:43380292-43380314 GGCCTTCTGGAAGGCGGTGGGGG + Intergenic
1180446270 22:15416952-15416974 AGGATTCAAGAACACAGTGGCGG + Intergenic
1181590612 22:23882772-23882794 TGCCTTCCGGAACACGGAGGAGG - Exonic
1185268858 22:49919057-49919079 GGACTCCAGGACCACGGTGGAGG - Intronic
950267828 3:11588380-11588402 GGCTTTCAGAACCACACTGGAGG + Intronic
950658399 3:14451634-14451656 TTCCTTAAGGAACACACTGGTGG + Intronic
952812318 3:37415491-37415513 GGCCTTGAGGAAAACATTAGAGG - Intronic
954165191 3:48751375-48751397 GGCCTTCAGAAGCAAAGTGGAGG + Exonic
954796134 3:53162008-53162030 GGCCTCCAGGGACCCAGGGGCGG - Intronic
954855976 3:53643743-53643765 AGGCTGCAGGGACACAGTGGAGG - Intronic
955535242 3:59916319-59916341 GGCCTTCAGCAACAGACTGAAGG + Intronic
956166820 3:66403626-66403648 GGCACTCAGGAAGGCAGTGGCGG + Intronic
958100651 3:89005169-89005191 GGCATTCAAGACCTCAGTGGAGG - Intergenic
958142323 3:89577873-89577895 GGCCTTTAAGAACACAGTAGTGG - Intergenic
959084205 3:101834228-101834250 GGCCTTGAGGATAATAGTGGTGG - Intronic
960597396 3:119418726-119418748 CACCTTCAGGAACACAGTTCTGG + Exonic
961547346 3:127644528-127644550 TGGCCTCAGGACCACAGTGGAGG + Intronic
961772860 3:129263038-129263060 GTCCTTCTGGAGCAGAGTGGAGG + Intronic
964683735 3:159370832-159370854 GGCCTTCAGAATCAGACTGGGGG + Intronic
969930858 4:10629379-10629401 GGCTTTCAGGAAGAGAGGGGAGG + Intronic
975180692 4:71340532-71340554 TGCCTTCAGGAATTCACTGGGGG + Intronic
978193165 4:105939465-105939487 GGCCTTCAAGGACACAGGGGAGG + Intronic
982998447 4:162381197-162381219 GGCCTCCATGATCCCAGTGGTGG + Intergenic
984768632 4:183419092-183419114 GGCATTCAGGACCACAGTCCGGG + Intergenic
985962868 5:3316147-3316169 TTCCATCAGGAACCCAGTGGAGG + Intergenic
991200519 5:63986506-63986528 GGGCTTCAGTCACCCAGTGGTGG + Intergenic
992013978 5:72557385-72557407 GTCCTACAGGAACACAGGCGTGG - Intergenic
992855970 5:80862113-80862135 AGCCTTGAGGAGCACAGTGTCGG + Intronic
993318352 5:86440358-86440380 GGCCTTCAGGCACAGACTGAAGG - Intergenic
994004896 5:94826439-94826461 GTTCTTCAGGAACACAGAAGTGG + Intronic
994425203 5:99576552-99576574 GGCCTGCAGGAGCACAGGGATGG + Intergenic
994436136 5:99735681-99735703 GGCCTGCAGGAGCACAGGGATGG - Intergenic
994883777 5:105531020-105531042 TGCTTTCAGGAATTCAGTGGTGG + Intergenic
996286184 5:121795753-121795775 GACCTGCAGGAGCACAGTGGGGG + Intergenic
997383878 5:133457383-133457405 GGCCTTCTGGAGCACACAGGTGG + Intronic
997829708 5:137139477-137139499 GGACTTCAGGAACAGAGGGAAGG + Intronic
999319062 5:150602034-150602056 GGCCATCGGGGAGACAGTGGTGG + Intronic
999593752 5:153178869-153178891 AACCTACAGCAACACAGTGGAGG - Intergenic
999707292 5:154285217-154285239 GGCCTCCAGGGACACTGTGAGGG + Intronic
1000464160 5:161554543-161554565 TGGCTTGAGGAACTCAGTGGTGG + Intronic
1001244749 5:170097821-170097843 GGAAATCAGGACCACAGTGGTGG - Intergenic
1002401370 5:178993271-178993293 GGCCTTCAGGGGCCCAGTTGGGG - Intronic
1002837605 6:878367-878389 GGCATAAAGGAACACAGAGGAGG - Intergenic
1003318339 6:5031295-5031317 GGCCTCCAGGCAGAAAGTGGAGG - Intergenic
1003648523 6:7936739-7936761 GGACTTCAGGAGACCAGTGGCGG - Intronic
1003754042 6:9096093-9096115 GACATGCAGGGACACAGTGGGGG + Intergenic
1004519977 6:16352715-16352737 GGGTTTCAGGAACCCACTGGGGG - Intronic
1005212861 6:23488703-23488725 GGCCTTCTGGAGCACAGTGCTGG + Intergenic
1006381661 6:33701788-33701810 GGGCTACAGGGACTCAGTGGGGG + Intronic
1007004695 6:38349776-38349798 AGACTTCAGGAACACAGGGAGGG + Intronic
1007149221 6:39671515-39671537 GGCCATCAGGAACATAGGGCAGG - Intronic
1010099297 6:72084572-72084594 AGCATTCAGGAACACAGTGAAGG + Intronic
1010342298 6:74768383-74768405 GGCCTCCAGGAACTCAGTCAAGG + Intergenic
1011400631 6:86957849-86957871 AGCCTACAGGAGCACAGTGGTGG + Intronic
1012825760 6:104144890-104144912 TGCCTGCAGGAACACAGAGTGGG - Intergenic
1012987072 6:105886549-105886571 GGACTTCAGGGACACAGAAGTGG + Intergenic
1015175016 6:130296797-130296819 GGCCTGCAGCCACACTGTGGTGG + Intronic
1016322162 6:142857956-142857978 GGCCATCAGGAAGCCAATGGTGG - Intronic
1016651981 6:146472500-146472522 GGCCATCAGGAATGCAGTGCTGG - Intergenic
1019054599 6:169213961-169213983 GGCCTTGAGGAACGCAGGTGTGG - Intergenic
1020563831 7:9771141-9771163 GGCCTTCAAAAAGACAGAGGAGG + Intergenic
1021463807 7:20918919-20918941 GGCATTCAATAACACAGTGCTGG + Intergenic
1023045235 7:36204735-36204757 GGCCTTCCGGAATATAGAGGGGG - Intronic
1024761209 7:52598185-52598207 GGCAGTCAGGAACATAGTTGGGG + Intergenic
1024780095 7:52837638-52837660 GGCCACCAGGAACACACTTGAGG + Intergenic
1024952359 7:54877984-54878006 GGCTTTCTGGGAAACAGTGGAGG - Intergenic
1026123645 7:67560042-67560064 GGGCTTTAGGAAGACAGAGGTGG - Intergenic
1026165306 7:67904054-67904076 GGCCTTCAGCCTCACACTGGGGG - Intergenic
1028812088 7:95099089-95099111 GGCTTTTAGAAACACAGTGCTGG + Intronic
1032974639 7:137208556-137208578 GTCCTTCAGGATTACAATGGTGG + Intergenic
1033305883 7:140225144-140225166 GGCCTTCAGGAAGACAGCCTTGG + Intergenic
1033636471 7:143216396-143216418 GGGCTTCAGGCACAGAGTGTTGG - Intergenic
1033861204 7:145630341-145630363 GGCCTTCAGCAACAGACTGATGG + Intergenic
1034073971 7:148214115-148214137 GGCCCCCTGGAACACAGGGGTGG - Intronic
1034238218 7:149589292-149589314 TGCCTTCAGTCACACACTGGAGG - Intergenic
1034417149 7:150971230-150971252 GGCCTGCAGGAGCACTGGGGAGG + Intronic
1035313774 7:157985640-157985662 AGGCTTCAGGACCACAGTGATGG - Intronic
1035606290 8:931720-931742 GGGCTGCTGAAACACAGTGGTGG + Intergenic
1035938991 8:3875104-3875126 GGGCTTCAGGAACACATTGTGGG + Intronic
1036211217 8:6842744-6842766 GGGATTCAGGGCCACAGTGGTGG - Intergenic
1037778130 8:21849109-21849131 GGCCTTCCCAAACACAGTGCAGG + Intergenic
1037782517 8:21880134-21880156 GGCATTTAGGCCCACAGTGGAGG + Intergenic
1039859519 8:41444901-41444923 GGACGTCAAGAACAGAGTGGGGG + Intergenic
1040074361 8:43213993-43214015 GGCCCACAGGAACACAACGGTGG - Intergenic
1041251529 8:55939515-55939537 GAACTGCAGGAACGCAGTGGGGG + Intronic
1041573533 8:59366352-59366374 GGTCTTCAGAAACACAGATGTGG + Intergenic
1042710605 8:71713048-71713070 GGCTGTGAGGAGCACAGTGGTGG - Intergenic
1042840983 8:73123610-73123632 GGCCTTCAGCAACAGACTGAAGG - Intronic
1043097521 8:75994460-75994482 GGCACTCAGGAACACAGTTGGGG + Intergenic
1044848439 8:96404870-96404892 GGGGCTCAGGAACACAGAGGGGG - Intergenic
1045746191 8:105425179-105425201 AGCCTTCAGGAACAGAATTGTGG + Intronic
1046481243 8:114821470-114821492 AGCCTGCAGGTACACAGTGCAGG - Intergenic
1047375824 8:124295058-124295080 GGCCTTCAGCCACAGACTGGAGG + Intergenic
1047389484 8:124438540-124438562 AGCCTTCAAGAACACATTGTGGG + Intergenic
1048136651 8:131752829-131752851 GGGCTACAGGAAACCAGTGGGGG - Intergenic
1049094656 8:140541175-140541197 GGCCTTCAGAGACACCGTCGCGG + Exonic
1050187506 9:2990388-2990410 GGCCCTCAGGAACACGATGTTGG + Intergenic
1050594089 9:7188615-7188637 GGCCTCATGGTACACAGTGGAGG - Intergenic
1050663300 9:7907570-7907592 GTCAGTCAGGAACACAGAGGTGG - Intergenic
1052556640 9:30027156-30027178 GGCCTTCAGCTACACACTGAAGG - Intergenic
1053057082 9:34999699-34999721 GGCCCTCAGGACCTGAGTGGTGG + Intergenic
1053421255 9:37980503-37980525 GGCCTTCAAGACTTCAGTGGAGG - Intronic
1056623182 9:88232429-88232451 TGCAGTCAGGAACCCAGTGGTGG + Intergenic
1058929535 9:109705282-109705304 GGCATCCAGTAACACAGGGGTGG - Intronic
1060793821 9:126501946-126501968 GGCCCTCAGGAACACGGCAGGGG - Intronic
1062483700 9:136763901-136763923 GGCCATCAGGCCCACAGAGGAGG - Exonic
1193082879 X:77423035-77423057 GGCCTCTAGGACCACATTGGGGG - Intergenic
1196411319 X:115422595-115422617 GGCCTTGAGGAGTTCAGTGGAGG + Intergenic
1197170278 X:123426266-123426288 AGCCTTCAGCAACACTGTGAAGG + Intronic
1199558921 X:149141642-149141664 GACCTTCACAAAGACAGTGGTGG - Intergenic
1199848156 X:151706559-151706581 GCCCTTCAGGCACACAGATGGGG + Intergenic