ID: 1175466337

View in Genome Browser
Species Human (GRCh38)
Location 20:59193025-59193047
Sequence GCACAGTCCCCACCCAAGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175466333_1175466337 8 Left 1175466333 20:59192994-59193016 CCTCTGCAGAAAGAGGCAGCAGG 0: 1
1: 0
2: 7
3: 42
4: 393
Right 1175466337 20:59193025-59193047 GCACAGTCCCCACCCAAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175466337 Original CRISPR GCACAGTCCCCACCCAAGAC AGG Exonic
900391848 1:2437034-2437056 CCACAGTCCCCAGCCCAGACAGG + Intronic
900581305 1:3411027-3411049 GCATGCGCCCCACCCAAGACTGG - Intronic
901066720 1:6497699-6497721 GCAGAGCCCCCACCCCAGCCCGG + Intronic
901659411 1:10789159-10789181 CCACACCCCCCACCCAAGACAGG + Intronic
902029382 1:13410576-13410598 GCACTGTCACCATCCCAGACCGG - Intronic
902814294 1:18907454-18907476 GGACAGTCCTAACCCAAGGCGGG + Exonic
903418589 1:23201838-23201860 CCACTGTGCCCAGCCAAGACAGG + Intergenic
904319982 1:29690303-29690325 GCACAGTCCCCAGACACGGCTGG + Intergenic
904479958 1:30787461-30787483 GCAAAGTCCCCAACCATGAGTGG - Intergenic
904648532 1:31986936-31986958 GCACATTCCCCACCCAGGGCAGG + Intergenic
905187577 1:36207587-36207609 CCGCAGTCCCCACCCCAGGCAGG + Intergenic
907329311 1:53660902-53660924 CCACAGTCAGCAGCCAAGACAGG + Intronic
911723530 1:101217425-101217447 GCAAAGGCCTCATCCAAGACTGG + Intergenic
912495737 1:110089976-110089998 GGACTGTCCTCAGCCAAGACAGG - Intergenic
912809898 1:112786138-112786160 CCACTGTGCCCAGCCAAGACTGG + Intergenic
912862435 1:113225987-113226009 ACACAGTCCTGAACCAAGACTGG + Intergenic
912919862 1:113855458-113855480 GCACACTCCACACTCCAGACTGG + Intronic
915534780 1:156528782-156528804 GCACAGTCCCTTCCTAAGTCTGG - Intronic
915687463 1:157648961-157648983 GCTCAGTGCCCACCCAATCCAGG + Intergenic
915891403 1:159777418-159777440 CCCAAGTCCCCACCCCAGACAGG + Intergenic
917416360 1:174814493-174814515 GCACAATCCCAGCCCAATACTGG - Intronic
918772305 1:188577160-188577182 GCACAGTGAACACCCAAGAGAGG + Intergenic
919763788 1:201114057-201114079 CCACAGTCCCCACCCAACCTGGG + Exonic
920402063 1:205682053-205682075 GGCCAGGCCCCACCCAATACAGG + Intergenic
920515951 1:206584758-206584780 CCACAGCTCCCACCCAAGGCCGG - Intronic
922175502 1:223194109-223194131 CCACTGTGCCCACCCCAGACTGG + Intergenic
922460225 1:225810062-225810084 GCGCAGTCTCCGCCCAAGCCCGG - Intergenic
924202133 1:241671630-241671652 GGACAGTGCCCATCCATGACTGG - Intronic
1063278966 10:4603368-4603390 GCACAGCCTCCAGCCAAGGCCGG - Intergenic
1068804768 10:61183182-61183204 GCACAGTCCCCATTTCAGACAGG + Intergenic
1070778486 10:79124024-79124046 CCACAACCCCCACCCAAGCCTGG + Intronic
1072719797 10:97773304-97773326 GTACCCTCCCCACCAAAGACTGG - Intergenic
1074289001 10:112124279-112124301 GCTGAGTCCCCACCCCAGTCTGG + Intergenic
1076255472 10:129021092-129021114 CCACCGCCCCCACCCAAGCCTGG - Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1077530428 11:3092400-3092422 CCACAGGCCCCACCCAGGGCTGG - Intronic
1079538789 11:21547027-21547049 CCACTGTCCCCACTCCAGACTGG - Intronic
1082041435 11:47688620-47688642 TCACAGTAACCACCCAAGGCAGG + Intronic
1083439496 11:62666465-62666487 GCACTGTCCCCACCTTCGACTGG + Exonic
1083741716 11:64714740-64714762 GCCCACCCCCCACCCAAGATTGG + Intronic
1084162138 11:67355689-67355711 GCACAGGCCCCAACCCAGGCTGG + Intronic
1085297618 11:75439809-75439831 GCCCAGCCCCCACCCCAGCCAGG - Intronic
1089858902 11:121571623-121571645 GCACAGGCCCCACGGATGACTGG - Intronic
1096714046 12:53480543-53480565 GGACAGTCCCCACCCCAATCAGG + Intronic
1097407191 12:59203537-59203559 ACAAGGTCCCCACCTAAGACAGG + Intergenic
1097637326 12:62138717-62138739 GCACAGTCCCCAGCAAAGTTTGG + Intronic
1101937410 12:109069563-109069585 CGACAGTCCCCACCCCAGGCAGG - Intronic
1102259372 12:111435096-111435118 GCACTCTCCCCACCCGAGACGGG + Intronic
1102351674 12:112197081-112197103 CCACTGTGCCCAGCCAAGACAGG + Intronic
1103716533 12:122948591-122948613 GCACAGTCCCCAGCAGAGACAGG + Intronic
1103897932 12:124286296-124286318 CCCCAATCCCCACCCCAGACTGG + Intronic
1104640372 12:130463218-130463240 GCCCAGTCCCAAACCCAGACAGG - Intronic
1104981726 12:132575984-132576006 CCCCAGTCTCCACCCAAGCCTGG + Intronic
1104985837 12:132596517-132596539 GGAACGTCCCCACCAAAGACAGG - Intergenic
1105212266 13:18264008-18264030 CCACCGTGCCCAGCCAAGACAGG + Intergenic
1105816343 13:24039872-24039894 GCACCGTCCCCACCAAAGACAGG + Intronic
1107913262 13:45124849-45124871 CCACTGTGCCCAGCCAAGACAGG + Intronic
1108163140 13:47663830-47663852 GCACAGTACCCACAGAAAACAGG + Intergenic
1112216176 13:97433829-97433851 GCGCAGTTCCCGCCCAAGCCAGG - Intergenic
1113670823 13:112174921-112174943 GCCCAGGCCCCACCAAGGACTGG + Intergenic
1114977792 14:28123510-28123532 GTCCAGTCCCCACGCAAGAAGGG - Intergenic
1119727567 14:76931047-76931069 CCACCGTGCCCAGCCAAGACTGG - Intergenic
1122314595 14:100818270-100818292 GCAGAGTCCCCACCCCAACCAGG + Intergenic
1122338355 14:101008250-101008272 GCACAGACGCCACCCATGTCAGG - Intergenic
1122623499 14:103072818-103072840 CCTCAGTCCGCACCCCAGACAGG - Intergenic
1122953487 14:105059122-105059144 GCACACTCCCCTCCCAGGGCAGG + Intronic
1123035994 14:105472159-105472181 GCCCAGGCCCCACCCAGCACCGG - Intergenic
1126919477 15:53504961-53504983 GGACAGTCCCCACCAAACAAAGG + Intergenic
1127533263 15:59865492-59865514 GTTCAGTCCCCAGCCAAGACTGG - Intergenic
1127857021 15:62961392-62961414 GCACAGTCCCCAACCTAGGAGGG - Intergenic
1132347460 15:101116902-101116924 GCTCTGTCCCCACCCAGGCCAGG + Intergenic
1132580363 16:681940-681962 GCACAGACCCAACACAAGGCGGG - Exonic
1136025482 16:27465602-27465624 GCACAGGCCACACCCAGGAAAGG + Intronic
1136473314 16:30496273-30496295 GCTTAGTCCCCAGCCAAGTCAGG + Exonic
1141409132 16:83820668-83820690 TCACAGGCCCCATCCAAGGCAGG + Intergenic
1141564989 16:84895334-84895356 GCACAGACCCTTCCCAAGAAGGG + Intronic
1141984352 16:87570427-87570449 GCCCAGTCCCCACCCCGCACGGG - Intergenic
1142202737 16:88768780-88768802 GCACCGCCCCCACCCCAGACTGG - Intronic
1142222455 16:88862201-88862223 GCAGAGTCCCCACCACAGCCAGG - Exonic
1144435759 17:15239194-15239216 GGAAGGTCCCCACCCAAGCCAGG - Intronic
1144733287 17:17540800-17540822 GCACAGTGCCCACTCATCACTGG + Intronic
1145308110 17:21686562-21686584 GCACAGGCCCCACCAAACCCCGG - Intergenic
1146913620 17:36664177-36664199 GCACACCCTCCTCCCAAGACTGG + Intergenic
1147123722 17:38351997-38352019 GCCTAGTCCCCACCCCAGCCCGG + Intergenic
1147561050 17:41509480-41509502 GCACCATCCCCACCCAAGCAAGG + Intergenic
1150726373 17:67654570-67654592 GCAAAGTCCCCAGCCCAGCCTGG - Intronic
1151241330 17:72760600-72760622 GCACAGACCTCCCCCAACACTGG + Intronic
1151365194 17:73612367-73612389 GCACAGTCCCCACCCTCACCGGG + Intronic
1152631714 17:81413520-81413542 GGACCGTCCCCACCCCAGCCAGG + Intronic
1152685743 17:81693156-81693178 GGACGGGCCCCACCCAAGAAGGG - Intronic
1152785471 17:82245779-82245801 GGACAGCCTCCCCCCAAGACTGG + Intronic
1154010840 18:10572503-10572525 GCCCTGTCCTCACCCAAGCCAGG + Intergenic
1154352135 18:13593028-13593050 CCACTGTGCCCAGCCAAGACTGG - Intronic
1154434955 18:14335937-14335959 GCACTGTCCCATCCCAGGACTGG - Intergenic
1155261648 18:24049530-24049552 GCACAGTGCCTACCCAGCACAGG - Intronic
1156894752 18:42233028-42233050 GCACCGTCTCCACACAAGAGTGG - Intergenic
1157130027 18:44998135-44998157 CCACAGTACCCACCCACTACTGG - Intronic
1157325141 18:46663545-46663567 GCAAAGTCTCCACCAAAGTCTGG + Intergenic
1157727212 18:49974125-49974147 GAACAGTCCCCAAGCAAGAATGG - Intronic
1158712349 18:59848745-59848767 GCATAGTGCCCACCTAAGATGGG - Intergenic
1160740464 19:683204-683226 CCACATTCCTCACCCCAGACCGG - Exonic
1161290482 19:3491235-3491257 GCAGAGTCCCACCCCAAGCCTGG + Exonic
1161300065 19:3538193-3538215 GCTCCGCCCCCACCCAAGGCCGG + Intronic
1161769833 19:6225192-6225214 TCACAGCCACCACCCAAGAGTGG - Intronic
1162352251 19:10157927-10157949 GGCCAGACCCCACCCATGACTGG + Intronic
1163040311 19:14597247-14597269 GCACAGTGCCCAGCAAAGATGGG - Intronic
1164254193 19:23512657-23512679 GCAAAGGCCCCACCAAATACCGG + Intergenic
1164739373 19:30565133-30565155 ACACATTCCCCACCCCAGAGGGG - Intronic
1165064160 19:33219438-33219460 GCACATTCCCCACACACCACAGG - Intronic
1167618035 19:50546964-50546986 GCTCGGTCACCACCCAGGACAGG + Intronic
1168327225 19:55544622-55544644 ACACAGGCCCCACCCCAGAGAGG - Intronic
1168697892 19:58415768-58415790 GCACAGTGTCCACATAAGACAGG - Intronic
926083930 2:10009617-10009639 GCACAGCCCCCACCGAACACAGG - Intergenic
929568735 2:43006578-43006600 ACAAAGTCCCCACCCATGACAGG - Intergenic
931684045 2:64778005-64778027 AAACAGTCCTCACCCAAAACTGG + Intergenic
933768867 2:85730272-85730294 GCTCTGTCCTCACCCAAGATTGG + Intergenic
934301357 2:91778394-91778416 CCACCGTGCCCAGCCAAGACAGG - Intergenic
934619947 2:95797762-95797784 CCACAAACCCCACCCAAGCCTGG - Intergenic
934640941 2:96026795-96026817 CCACAAACCCCACCCAAGCCTGG + Exonic
938279081 2:130051942-130051964 GCACAGACTCCACCCAGGAGGGG - Intergenic
938330068 2:130442818-130442840 GCACAGCCTCCACCCAGGAGGGG - Intergenic
938359877 2:130678685-130678707 GCACAGCCTCCACCCAGGAGGGG + Intergenic
938436289 2:131285406-131285428 GCACAGACTCCACCCAGGAGGGG + Intronic
941879325 2:170465158-170465180 CCACTGTGCCCAGCCAAGACTGG + Intronic
1171221197 20:23399441-23399463 GAACAGTCCTCACCAAATACGGG + Intronic
1171880816 20:30616491-30616513 GCACCGTCCCATCCCAGGACTGG + Intergenic
1172020718 20:31911900-31911922 GCCCACTCTCCACCCGAGACAGG - Intronic
1172921522 20:38486926-38486948 GCAAGGTCCCCACCCAAAAAAGG + Intronic
1173744032 20:45422917-45422939 CCACTGTGCCCACCCAAGAGAGG - Intronic
1175466337 20:59193025-59193047 GCACAGTCCCCACCCAAGACAGG + Exonic
1176842080 21:13849765-13849787 GCACTGTCCCATCCCAGGACTGG + Intergenic
1177148310 21:17430052-17430074 TCCCAGTCCCCACCCAACTCTGG + Intergenic
1179123115 21:38567067-38567089 GCACAATCCCCCCCCCAGTCTGG - Intronic
1179724438 21:43333971-43333993 GCTCTGTCACCACCCAAGAGGGG + Intergenic
1179802620 21:43818040-43818062 GCACGGCCCCCACCCAGGCCCGG - Intergenic
1180161661 21:46001022-46001044 CCACAGGCCCCACCCTAGCCTGG + Intronic
1180181279 21:46119713-46119735 GCACAGCCCCCACCCTCCACAGG + Intronic
1180815078 22:18784326-18784348 CCACCGTGCCCAGCCAAGACAGG + Intergenic
1180898439 22:19353905-19353927 GCACAGTCCCTGCCCAGGCCTGG - Intronic
1180969969 22:19810260-19810282 ACACAGTCCCCAACCAAGGAAGG + Intronic
1181201266 22:21218663-21218685 CCACCGTGCCCAGCCAAGACAGG + Intronic
1181700477 22:24618301-24618323 CCACCGTGCCCAGCCAAGACAGG - Intronic
1182747829 22:32619123-32619145 TCTCAGGCCCCACCCCAGACCGG + Intronic
1183508209 22:38220857-38220879 TCACAGGCCCCACCCAGGAAGGG - Exonic
1184550121 22:45200000-45200022 GCACACCCCCCACCCCAGAACGG - Exonic
1203225647 22_KI270731v1_random:76767-76789 CCACCGTGCCCAGCCAAGACAGG - Intergenic
1203265181 22_KI270734v1_random:10017-10039 CCACCGTGCCCAGCCAAGACAGG + Intergenic
949494645 3:4620169-4620191 GCACAGGCTCCACCCCAGCCAGG - Intronic
950076037 3:10187994-10188016 CCACAGTCCCCTCCTAAGCCTGG - Intronic
950811945 3:15657661-15657683 GGACCATCCCCACCCAAGAAGGG - Intergenic
951038732 3:17964808-17964830 TCATAGTCCCCAGACAAGACAGG + Intronic
951847683 3:27102011-27102033 GGACAGTTCCCATCAAAGACAGG + Intergenic
953927006 3:46987775-46987797 CCACAAGCCCCACCCAGGACAGG + Intronic
954201215 3:49024463-49024485 GCAGAGGCCCCACCAAGGACAGG + Intronic
954292858 3:49658839-49658861 TCACAGTCCCCATCCATCACTGG - Intronic
956323300 3:68023274-68023296 GCACAGCCCCCACCCAACCTTGG - Intronic
961381612 3:126499425-126499447 GGACAGTCACCACCCAAGGCAGG + Intronic
963222985 3:142831351-142831373 GCAAAGTCCCCACGCAGCACAGG - Intronic
968662683 4:1805277-1805299 CCACGGTCCCCACCCCAGCCTGG - Intronic
969507886 4:7599381-7599403 GCACCGTCCCCCGCCAAGCCCGG + Intronic
969880527 4:10169870-10169892 GCACTATCCCCAGCCAAGATTGG + Intergenic
970820278 4:20204285-20204307 GGACTGTCCCTACCCAAAACTGG - Intergenic
972545305 4:40074717-40074739 GCACCATGCCCAGCCAAGACTGG - Intronic
972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG + Intronic
974877407 4:67716150-67716172 ACGTTGTCCCCACCCAAGACAGG + Intergenic
975214700 4:71739409-71739431 GAACAGGACCTACCCAAGACTGG - Intergenic
980180446 4:129394203-129394225 GCACAGATTCCAGCCAAGACTGG + Intergenic
983079905 4:163372270-163372292 GCACAGCCTCCGACCAAGACCGG - Intergenic
983976838 4:173944963-173944985 GCACAGTCCCCAAAGAAGAGAGG + Intergenic
986046979 5:4048308-4048330 GCAGAGCCCCCACCGAAGAATGG + Intergenic
987244138 5:16031048-16031070 ACACAGTCACAACCAAAGACTGG + Intergenic
991138445 5:63211069-63211091 GCAAAGACCTCACCCAATACAGG - Intergenic
993704048 5:91149542-91149564 CCACCGTGCCCAGCCAAGACTGG - Intronic
1001906407 5:175477309-175477331 CCACAGTGCCCAGCCAAGAAGGG + Intronic
1002279862 5:178123849-178123871 ACACAGGCTCCACCCAAGCCTGG - Exonic
1002373862 5:178774796-178774818 GCAGTGTCCACACCCAAGACAGG - Intergenic
1002790947 6:437003-437025 GCGCAGTTCCCTCCCAGGACAGG + Intergenic
1003520370 6:6853529-6853551 GCACCGTGCCTAGCCAAGACAGG - Intergenic
1004191235 6:13465608-13465630 GCCCAGGCCGCACCCCAGACCGG - Intronic
1005661394 6:28002494-28002516 TAACAGTCCCCACCCTGGACAGG + Intergenic
1006152876 6:31998662-31998684 GCACAGTCCACACACACGAGTGG - Intronic
1006159184 6:32031399-32031421 GCACAGTCCACACACACGAGTGG - Intronic
1006878653 6:37320200-37320222 GCACAGTCCCTAACCTTGACAGG - Intronic
1019416762 7:931195-931217 GCACCGTCCCCACCCTGGCCAGG - Intronic
1019589946 7:1825914-1825936 GCACAGTCCCAGCCCCAGGCGGG + Intronic
1020030557 7:4929808-4929830 CCACTGTGCCCAGCCAAGACTGG + Intronic
1028783660 7:94767432-94767454 GCACAGTCTCCAACAAATACTGG - Intergenic
1029065247 7:97842769-97842791 TCCCAGTCCCCACCCAACTCAGG + Intergenic
1029976797 7:104842378-104842400 GCCCAGTCCCCTCCCCAGGCAGG - Intronic
1031137451 7:117900543-117900565 GCACTGTCACCACCCAACATAGG - Intergenic
1031384410 7:121130204-121130226 GCTCAGTCCTGACCCAATACTGG + Exonic
1034435462 7:151060946-151060968 GCACAGGGGGCACCCAAGACTGG - Intronic
1035388606 7:158490405-158490427 CCTCAGTCCCCACCCAGGAAGGG + Intronic
1036637984 8:10564628-10564650 TCACTGTCCCCAACCAATACCGG - Intergenic
1045096312 8:98801049-98801071 TCCAAGTCCCCACCCAACACAGG - Intronic
1048201802 8:132380774-132380796 GCACAGTACCCACCTAATACAGG - Intronic
1049007367 8:139863942-139863964 CCACAGTTCCCAGCCAGGACTGG + Intronic
1049584683 8:143427461-143427483 GCACAGCCCCCTCCCAAGAAAGG + Intronic
1049643186 8:143724751-143724773 GCACAGGCCCGGCCCAAGCCAGG - Exonic
1050019824 9:1271226-1271248 CCACAGTTCCCACCCAACACTGG + Intergenic
1051603124 9:18893961-18893983 ACACATTCCCCTCCCAAGACAGG - Intronic
1053666900 9:40323311-40323333 GCACCGTCCCATCCCAAGACCGG - Intronic
1054517709 9:66052972-66052994 GCACCGTCCCATCCCAAGACCGG + Intergenic
1056879780 9:90380086-90380108 GCACAGGGGCCACCAAAGACTGG - Intergenic
1057886043 9:98830457-98830479 GCACATTCTCCAGCCACGACTGG + Intronic
1058893173 9:109378756-109378778 GCACACTCAGCACCCAGGACTGG - Exonic
1060452561 9:123756856-123756878 GCCCAGGCCCAACCCAAGCCTGG + Intronic
1060555779 9:124506592-124506614 GCCCAGCCCCCACCCAACCCCGG - Intronic
1061177741 9:129007868-129007890 GCACAGGCCCCGCAGAAGACAGG + Intronic
1061325677 9:129862616-129862638 CCACGGTGCCCAGCCAAGACAGG - Intronic
1062057401 9:134475651-134475673 GCACAGCCCCCACCCCATCCTGG - Intergenic
1186079878 X:5919502-5919524 GCCCAGTCCCTAACCAAAACTGG - Intronic
1190382824 X:49855999-49856021 TCCCACTCCCCACTCAAGACTGG + Intergenic
1192169386 X:68844790-68844812 GACCAGCCCCCACCCAGGACAGG + Intergenic
1193257358 X:79366429-79366451 GCACAGTGAACACCCAACACTGG + Intronic
1195329686 X:103786791-103786813 GCCTCGTCCCCACCCAAGGCTGG + Intronic
1197056278 X:122123587-122123609 GCAAAGTACCCAGCCAAGATTGG + Intergenic
1199672033 X:150155559-150155581 TCAGAGGCCCCACCCAGGACTGG + Intergenic
1200217188 X:154373143-154373165 GCACGGGCCCCATTCAAGACGGG + Intronic