ID: 1175468660

View in Genome Browser
Species Human (GRCh38)
Location 20:59210218-59210240
Sequence CAATTAAAACAGAATTGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 425}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175468660 Original CRISPR CAATTAAAACAGAATTGCCC CGG Intronic
900963476 1:5941064-5941086 AAATTAAAACAGTATGGCCATGG + Intronic
901111403 1:6799226-6799248 AAATTAAAAAAGAATTAGCCGGG - Intronic
901341052 1:8499822-8499844 AAATTAAAACACAATGGGCCTGG + Intronic
901619807 1:10574813-10574835 CAAAAGAAACAGAATTGGCCGGG + Intronic
902740981 1:18437810-18437832 TTATTAACACAGAATTTCCCAGG - Intergenic
903472516 1:23597257-23597279 CAATTTAAACACAAATGCCATGG + Intronic
903997187 1:27314690-27314712 CAATTAAAACAGAATCTCTGGGG - Intergenic
904185716 1:28702754-28702776 CAAAGAAATCAGAATTGGCCGGG + Intronic
905363085 1:37433748-37433770 CAAACAAAAGAGAATTGCCAGGG + Intergenic
907179647 1:52558310-52558332 AAAATAAAAAAGAATTGGCCGGG - Intergenic
907855435 1:58299081-58299103 CAATACAGACAGAATTTCCCAGG - Intronic
908517129 1:64904539-64904561 CCATTAAAAAAGAAGTGCCTTGG - Intronic
908580001 1:65504954-65504976 CAATTAAATCAGAATTTCTAGGG + Intronic
908689653 1:66764025-66764047 AAATTAAAACAAAATTAGCCAGG + Intronic
909070941 1:70992928-70992950 CATTTATAACAACATTGCCCTGG + Intronic
910106040 1:83632186-83632208 GAATTAAAACAGAGTTGACAAGG + Intergenic
910627360 1:89322373-89322395 CCAAAACAACAGAATTGCCCAGG + Intergenic
912077735 1:105897871-105897893 CAAATACAACAAAATTACCCAGG + Intergenic
912347662 1:108979797-108979819 TAAGAAAAACAGCATTGCCCTGG - Intronic
912679557 1:111720479-111720501 ACATTAAAATAGAATTGGCCTGG + Intronic
913426217 1:118733416-118733438 CAATTAAAACAAAAAAGTCCAGG + Intergenic
915038643 1:152949231-152949253 CAATTAAAACAGAATTCCTCTGG + Intergenic
916140028 1:161688482-161688504 CAATTAAAACAGTATTGGAATGG - Intergenic
916140280 1:161691295-161691317 AAATTAAAACATTATTGCTCAGG - Intergenic
916539561 1:165739812-165739834 AAATTAAAACAGAATGGGGCCGG + Intronic
916737069 1:167617569-167617591 GAATTAAAACAGAAATGTCAAGG + Intergenic
916804501 1:168245078-168245100 CAATTAAAACATGATTGCAGTGG - Exonic
916992369 1:170257685-170257707 CAATTAAACAAGAATTCCCTGGG - Intergenic
917106993 1:171502318-171502340 CAATTAAATCAGAATTTCTTGGG - Intronic
917202218 1:172529894-172529916 CAGTTAAAACAGAAGTTTCCTGG - Intergenic
917511696 1:175674303-175674325 CATTTTAAACAGAATTGCTCAGG - Intronic
918715537 1:187781584-187781606 AAAATACAACAGAATTGGCCTGG - Intergenic
918825871 1:189323994-189324016 GAATCAAAACAGAATAGCTCTGG + Intergenic
919042970 1:192415370-192415392 CTTTTAAAGCAGAATTTCCCAGG + Intergenic
920501630 1:206489016-206489038 CAATATAAACAGAATTGCTAAGG - Intronic
920515129 1:206579698-206579720 CAATTAAATCAGAATCTCCAGGG + Intronic
921103163 1:211948998-211949020 CAATTAAGAGAGCATTGTCCAGG - Intronic
921712457 1:218386620-218386642 CAAACAAACCAGAATGGCCCTGG - Intronic
922708936 1:227812483-227812505 CAATCAAAACAGAATGATCCTGG + Intergenic
923234002 1:232014993-232015015 CAATAGAAACAGAACTGCGCAGG + Intronic
924488038 1:244506431-244506453 CAATAAAAATAGAATTACCATGG - Intronic
1063466762 10:6250989-6251011 CAATTAAAACAGAATCTCTGTGG - Intergenic
1064780418 10:18831745-18831767 CAATTCAATCAGAATCTCCCCGG - Intergenic
1065273235 10:24058268-24058290 TAATTAAAACAGAATGGTGCTGG - Intronic
1065415796 10:25484157-25484179 CAAACAGAACAGAATTGCCGTGG - Intronic
1065608923 10:27451303-27451325 AAATTAAAAAAGAATTAGCCTGG - Intergenic
1065809159 10:29425310-29425332 CAATTAAAATAGAAATCCCTGGG + Intergenic
1067546416 10:47195515-47195537 CAATCAAAACAACTTTGCCCTGG - Intergenic
1068151673 10:53140294-53140316 CAATTAAAACAGTATTGGGGTGG - Intergenic
1068358191 10:55939275-55939297 CAATTGAATCAGAATTGCTCGGG - Intergenic
1068457810 10:57281505-57281527 CAATGAAAACAGAAGTGTCTTGG + Intergenic
1068934170 10:62620051-62620073 CAATTAAATCAGAATTGTTAAGG - Intronic
1069537027 10:69261377-69261399 AAATAAAAACAGAAAGGCCCTGG + Intronic
1070503620 10:77094277-77094299 CAAGTAAAAGTGACTTGCCCAGG + Intronic
1071585368 10:86815332-86815354 AAATTAAAACAGAATTGAACAGG - Intronic
1072479212 10:95794506-95794528 CAATTAAATCAGAATCCCTCGGG - Intronic
1073352103 10:102827384-102827406 CACTTAAAAAAAAATTGGCCGGG - Intergenic
1073522260 10:104144002-104144024 AGATAAAAACAGAATTGGCCAGG - Intronic
1073530867 10:104231210-104231232 TAATTATAAAAGAATGGCCCAGG - Intronic
1073799383 10:107024689-107024711 CAAATAAAACAAGATTGACCAGG - Intronic
1073901622 10:108229163-108229185 CAAACAAAACAGAATTTCTCTGG + Intergenic
1074006173 10:109426787-109426809 CAATTGAAGCAGATTTGGCCAGG + Intergenic
1074715751 10:116217097-116217119 AACTGAAAACAGAACTGCCCTGG - Intronic
1075249880 10:120858049-120858071 GAATTTAATCAGATTTGCCCTGG + Intronic
1075582252 10:123629732-123629754 CAATTCATTCAGAATTGCCATGG - Intergenic
1075836375 10:125456868-125456890 AAATTAAAAAAGAATAGGCCAGG + Intergenic
1076091567 10:127690725-127690747 CATTTAAAACAGACTTGAGCTGG - Intergenic
1077586056 11:3454115-3454137 CATCTAAAAAAGAATTGCCCAGG - Intergenic
1078643780 11:13119556-13119578 CAATAACAACAGCATTGCTCAGG + Intergenic
1078948948 11:16106310-16106332 CAATTAAAACAGGATGGTACTGG + Intronic
1079253626 11:18807601-18807623 CAATCAAAACAGCATTGTACTGG - Intergenic
1079945561 11:26736539-26736561 TAATTAAAACAGAATGGTACTGG + Intergenic
1080507578 11:32931996-32932018 TACTTAATACAGAACTGCCCAGG - Exonic
1080967408 11:37229253-37229275 CACTTAAAACAAAATTGACTTGG + Intergenic
1081024936 11:37999647-37999669 CAATTAAGTCAGAATTTCCAAGG + Intergenic
1084299419 11:68237019-68237041 CAATTAAGAAAGAATAGTCCGGG - Intergenic
1085029549 11:73262158-73262180 CAATTAAAACAAAATTGGCTTGG - Intergenic
1086289710 11:85293265-85293287 CAATTAGAACAAAATGGGCCAGG + Intronic
1086953463 11:92913572-92913594 AAAGTAAAACTGATTTGCCCAGG + Intergenic
1087658489 11:100956270-100956292 CAACTAAATCAGAACTGGCCAGG + Intronic
1088005554 11:104934887-104934909 AACTTAAAACAGAACTGCCAGGG + Intergenic
1088213516 11:107482338-107482360 CAATTAAAAAGAAAGTGCCCTGG - Intergenic
1088213992 11:107487390-107487412 CAATTAAAACAGTATGGAACTGG + Intergenic
1088342982 11:108789944-108789966 CAATTAAATCAGAATAGCTGGGG + Intronic
1088520816 11:110697797-110697819 CAACTAAAACAGCATGGTCCTGG - Intronic
1088671020 11:112140695-112140717 CAATTAAAAAAAAATTAGCCAGG + Intronic
1088996676 11:115006446-115006468 AAATTAAAACAGCAATGCCTAGG - Intergenic
1089662911 11:119997208-119997230 CAATTAAAACAGAATCTCAGCGG + Intergenic
1090889007 11:130906297-130906319 CAAGTAAAACAGGCCTGCCCTGG + Intronic
1091493897 12:955765-955787 CAAAAAAAACAAAAATGCCCAGG - Intronic
1092620299 12:10257866-10257888 CAGTTAATAGAGAATTGCCTTGG - Intergenic
1092814127 12:12297984-12298006 CAATTAAAAAAAAATTAGCCAGG + Intergenic
1092980869 12:13793015-13793037 CAAGTAACACAGACTTCCCCAGG - Intronic
1093993688 12:25618276-25618298 CAATTAAATCAGAATTCCCAAGG - Intronic
1095448033 12:42302030-42302052 CATTTCAAGAAGAATTGCCCAGG - Intronic
1095597367 12:43974576-43974598 AAATTAAAACAGAAATTCCAAGG - Intronic
1096102122 12:48976151-48976173 CATTTAAAACACAAGTGCCCGGG + Intergenic
1096945514 12:55404000-55404022 CAATCAAAACAGTATGGCACTGG + Intergenic
1097584057 12:61494119-61494141 CAATTAAAAAAAAATAGGCCAGG + Intergenic
1097679459 12:62634903-62634925 CAATTAAATCAGAATCCCCCAGG - Intergenic
1098914662 12:76244854-76244876 CAATTAAAACTGACCTGGCCAGG + Intergenic
1100436585 12:94576776-94576798 CCTTTAAAAAAAAATTGCCCAGG - Intronic
1101769696 12:107737744-107737766 CAATTAAATTAGAATTCCCATGG + Intronic
1101779026 12:107818931-107818953 CAATTCAAACATAAATTCCCTGG + Intergenic
1101912325 12:108869413-108869435 AAATTAAAACAGAATGGGGCCGG + Intronic
1101943011 12:109114427-109114449 CAATTAAATCAGAATTTCCAGGG - Intergenic
1103395055 12:120600898-120600920 CAATTAAAATAAAATTCCCAAGG + Intergenic
1104514237 12:129409231-129409253 CAAATAAAAGAGAATTTCTCTGG - Intronic
1105564037 13:21525484-21525506 AAATTAAATCAGCATTGGCCAGG - Intronic
1109464322 13:62709263-62709285 TAATTAAAACAGTATTGTACTGG - Intergenic
1110336373 13:74336064-74336086 CAATTTTAACAGAATTTTCCTGG + Intergenic
1110491626 13:76116770-76116792 CAATCAAAACAGCATTGTGCTGG + Intergenic
1112607099 13:100917226-100917248 CAATTAAATCAGAATTTCTGGGG - Intergenic
1112913398 13:104517789-104517811 CAATTAAAACAGTATGGTACTGG - Intergenic
1113062429 13:106337714-106337736 CTATTAAAACAGAATCTCCAAGG + Intergenic
1113210785 13:107977676-107977698 CAATTAAAGCAGAACTAACCTGG + Intergenic
1113597674 13:111546265-111546287 CAATTCAAACAGCAAAGCCCTGG - Intergenic
1114062254 14:19028259-19028281 CAATCAAAGCAGACTTTCCCTGG + Intergenic
1114100005 14:19371734-19371756 CAATCAAAGCAGACTTTCCCTGG - Intergenic
1114867610 14:26616534-26616556 AAATCAAAACAGCATTGCACTGG + Intergenic
1116309865 14:43311252-43311274 AAAATAAAACAAAATTACCCAGG + Intergenic
1116898701 14:50341427-50341449 CAATTAAAACAGAATCCCTGGGG + Intronic
1116937139 14:50752401-50752423 TAATTAAAACAGTATGGTCCTGG - Intronic
1117823552 14:59676729-59676751 CAATCAAATCAGAATTGCTGGGG + Intronic
1118120378 14:62833505-62833527 TAATTAAAACAGTATGGTCCTGG - Intronic
1120052863 14:79888405-79888427 CAATTACATCAGAATCACCCAGG - Intergenic
1120121818 14:80689759-80689781 CCATTAAAAAAGAACTTCCCTGG - Intronic
1121692687 14:95889210-95889232 CCATGAAAACAGAATTGCCCAGG - Intergenic
1122477492 14:102021080-102021102 CAATTAAAAAAAAATTGGCTGGG + Intronic
1122747194 14:103905390-103905412 CAATAAAACCAGAATAGGCCGGG + Intergenic
1122763319 14:104046592-104046614 CAATTAAGACAGTATAGCACTGG - Intronic
1123494553 15:20813208-20813230 CAATCAAAGCAGACTTTCCCTGG - Intergenic
1123551048 15:21382301-21382323 CAATCAAAGCAGACTTTCCCTGG - Intergenic
1123983838 15:25626720-25626742 CAATAAAAACAGATTGGCCTGGG + Intergenic
1124079874 15:26482679-26482701 CAATTAAGACAGTGTTGCACTGG + Intergenic
1124123778 15:26916449-26916471 CAATTAAAACAGTATGGCACAGG - Intronic
1124205530 15:27715780-27715802 AAAATAATACAGAAATGCCCGGG + Intergenic
1125061013 15:35423943-35423965 TAATGAAAACAGAATGGCACTGG - Intronic
1125485836 15:40110173-40110195 AAAATAAAAAAGAATAGCCCAGG + Intergenic
1126041792 15:44598422-44598444 CTATTCAAACAGAAATGCTCAGG - Intronic
1126062618 15:44798319-44798341 TAATGAAAACTGAATTGGCCTGG + Intergenic
1127828835 15:62731579-62731601 CCAAAAAAACAGAATAGCCCTGG - Intronic
1128237404 15:66077714-66077736 CAATCAAACCAAAACTGCCCAGG + Intronic
1128838251 15:70828794-70828816 CAATTAAATCAGAATATCTCAGG + Intergenic
1129015454 15:72464074-72464096 TTATTAAAACAGAATAGTCCTGG - Intergenic
1129629227 15:77239319-77239341 CAATTAAAATAGAATTTCTGGGG - Intronic
1130347234 15:83059248-83059270 TAATTAAAACAAAGTTGGCCGGG + Intronic
1130366247 15:83241932-83241954 CAATTAAAACAGTATGGTACTGG + Intergenic
1202959391 15_KI270727v1_random:109544-109566 CAATCAAAGCAGACTTTCCCTGG - Intergenic
1133616727 16:7483803-7483825 CAGTTAAAGCAGAATTTCCCAGG - Intronic
1134202224 16:12208678-12208700 CAGTTAAAAAAAAATTGGCCAGG + Intronic
1134387475 16:13787296-13787318 GAAGTAAAACATAATTGGCCGGG - Intergenic
1135196667 16:20400525-20400547 CAATTAATTCAGAATTGCTCAGG + Intronic
1135375772 16:21946018-21946040 CAATTAAAACAAAATTGAGCCGG + Intergenic
1135614692 16:23901111-23901133 TAATCAAAACACAATTGCCAAGG + Intronic
1136936918 16:34477905-34477927 AAATTAAAACACAATGACCCAGG - Intergenic
1136962901 16:34870665-34870687 AAATTAAAACACAATGACCCAGG + Intergenic
1137605652 16:49785236-49785258 GAATAAAAACAAAATAGCCCTGG - Intronic
1138852251 16:60642938-60642960 CAATTCAATCAGAATCTCCCAGG - Intergenic
1139768719 16:69255026-69255048 CAATAAAGACAGAAATGGCCTGG - Intronic
1140101972 16:71925660-71925682 CAATTAAAAAAGTACTGGCCAGG + Intronic
1140576205 16:76172365-76172387 CAATCAAAACAGTATGGCACTGG - Intergenic
1141168254 16:81675008-81675030 TAATTAAATCAGAATGGCACTGG - Intronic
1142593504 17:1018340-1018362 CAATTAAAAAATAAGGGCCCGGG - Intronic
1143398996 17:6628567-6628589 AAAATGAAACAGAACTGCCCAGG + Exonic
1143911770 17:10256232-10256254 CAATTAAATCAGAATGTCCTGGG - Intergenic
1143950831 17:10631055-10631077 TAATGAAAAAAGAATTTCCCTGG - Intronic
1143997511 17:11020054-11020076 CAATTAAAACACAACTTACCAGG - Intergenic
1147032182 17:37647744-37647766 CAATTAAACCAGAATTTCTGGGG - Intergenic
1147169799 17:38611342-38611364 CAAACAAAAAAGAATTGCCCGGG + Intergenic
1147797154 17:43052639-43052661 CAATAAAAAGAAAATTGCCAAGG + Intronic
1148274454 17:46291002-46291024 CAAATAAACCTGAATGGCCCTGG + Intronic
1148917659 17:50996274-50996296 ATATTAAACCAGAATTGCTCTGG + Intronic
1149292006 17:55226318-55226340 AAATAAAAACAGAACTGCTCTGG + Intergenic
1150408601 17:64923553-64923575 CAAATAAACCTGAATGGCCCTGG - Intergenic
1151019500 17:70598634-70598656 AAAGTAAAACAGAAATGGCCAGG + Intergenic
1151119325 17:71774525-71774547 CAATTAAATCAGAATCTCACTGG - Intergenic
1151754137 17:76061979-76062001 AAATTAAAAAAAAATTACCCGGG + Intronic
1151766263 17:76135000-76135022 CAATTAGACCAGAATTTCCGGGG - Intergenic
1152520123 17:80850941-80850963 AAATTAAAACAGAATTGCTAAGG - Intronic
1153019011 18:610138-610160 AAATTAAAACACATTTGCCAGGG + Intronic
1153347455 18:4043319-4043341 AAATTAAAACAGAATTGTCAAGG + Intronic
1155107610 18:22683221-22683243 GAATTGAAACAGACCTGCCCTGG - Intergenic
1156641759 18:39109441-39109463 TAAATAAAATAAAATTGCCCTGG + Intergenic
1156761621 18:40598415-40598437 CAATAAAAACAGAATTTGGCTGG + Intergenic
1156948789 18:42867896-42867918 CAATTAAATCAGAATTTCTGGGG + Intronic
1157241326 18:46012477-46012499 CAATTAAAAAAGAGTTGGCCAGG + Intronic
1157526879 18:48390102-48390124 TAATTAAAACAGAAAAGCACAGG - Intronic
1157662667 18:49459811-49459833 CAGTCAAAACACAATTGCTCAGG + Intronic
1157842594 18:50972776-50972798 TAATTAAAACAGAATAGGCCGGG - Intronic
1157978312 18:52351646-52351668 CTATAAAAATAGAATTGCCATGG + Intronic
1158301630 18:56058959-56058981 AAAATAAAACAGAATTATCCTGG - Intergenic
1158387479 18:57012137-57012159 CTCTTAAAACAGAGTTGTCCTGG - Intronic
1158408339 18:57180288-57180310 CAATTAAATCAGAATCTCCGGGG - Intergenic
1158570803 18:58595658-58595680 CAATTAAAACAGAATTTTTTAGG + Intronic
1158766729 18:60459347-60459369 CAATTTAAATAGAAATGCTCAGG - Intergenic
1159474819 18:68907188-68907210 CAATCAAAACAGTATAGCACTGG - Intronic
1159771055 18:72545185-72545207 CATTTAGAACAGAACTGCCAAGG + Intronic
1160181909 18:76644313-76644335 TAATTAAAAGAGGACTGCCCAGG - Intergenic
1161786250 19:6327779-6327801 CAATAAAAAAAAAATTGGCCAGG + Intronic
1163487970 19:17600366-17600388 CATTTAAAACAGACATGGCCAGG + Intergenic
1163559724 19:18011706-18011728 CAAATAATACAAAATTACCCAGG + Intronic
1163812863 19:19444895-19444917 CAAATAAAACAAAACTGCCATGG - Intronic
1163920505 19:20284245-20284267 CAATTCTAACACAATTGCACAGG + Intergenic
1163999081 19:21080632-21080654 CGAATAAAATAGAATCGCCCAGG - Intergenic
1165335423 19:35166404-35166426 CATTTAAAACAAAATTGCCCAGG - Intronic
1165580436 19:36858124-36858146 CAATTAAATCAGAATTGCTGAGG - Intronic
1165957239 19:39508746-39508768 AAATTAAAACAAAATTAGCCAGG + Intergenic
1167243258 19:48358088-48358110 TAATTAAAAAAGAATGGGCCAGG + Intronic
925938534 2:8791839-8791861 CAATTAAAACAAAATTCTCATGG - Intronic
926732675 2:16048877-16048899 TAATAAAAAAAGAATTGACCAGG - Intergenic
926848534 2:17169094-17169116 CAACTAAATCAGACTTGCCGGGG + Intergenic
928062740 2:28131374-28131396 CAATTAAAAAATAATAGGCCGGG - Intronic
930365257 2:50431630-50431652 AAATGAAAACATAATTGTCCAGG + Intronic
931811877 2:65862166-65862188 CAATTAGATCAGAATCTCCCAGG - Intergenic
932000327 2:67878943-67878965 CAATTAAATCAGAATTTCTTGGG - Intergenic
932197366 2:69796212-69796234 CACTTTAAGAAGAATTGCCCAGG - Intronic
932210354 2:69923189-69923211 CAATTAAATCAGAATTGCTAAGG - Intronic
933571416 2:84017783-84017805 CAATTAAATCAGAATTTCTAAGG + Intergenic
933597532 2:84297149-84297171 TAAATAAAAAAGAATTTCCCTGG - Intergenic
933974576 2:87497858-87497880 CAAAGAAACCTGAATTGCCCAGG + Intergenic
934196786 2:89843825-89843847 AAGTTAAAACAGTATTCCCCAGG + Intergenic
935913017 2:107917926-107917948 TAATTAAAACAGAATGGCACTGG - Intergenic
936120165 2:109734758-109734780 TAATTAAAACAGAATAGCATTGG + Intergenic
936319248 2:111452956-111452978 CAAAGAAACCTGAATTGCCCAGG - Intergenic
936929357 2:117771511-117771533 CAATTAAATCAGAATCTCCAGGG + Intergenic
936955489 2:118018037-118018059 CAATTAAATCAGGATTGCTAAGG - Intergenic
936969393 2:118162750-118162772 TAATTAAAACAGAATTGTCATGG + Intergenic
937018258 2:118626867-118626889 CAATTACAACAAAATTGCAAAGG + Intergenic
937125713 2:119473942-119473964 CATTTAAAACAGAACTTCCATGG - Intronic
937136877 2:119560991-119561013 CAATTAAAAAAAAAATGGCCAGG + Intronic
937710688 2:124977205-124977227 CAATTAAACCAGAATGTCCTGGG + Intergenic
938479617 2:131648444-131648466 CAATCAAAGCAGACTTTCCCTGG + Intergenic
939651218 2:144764790-144764812 CATTTAAAAAAAAATTGCCAAGG - Intergenic
939767473 2:146269029-146269051 GAATAAAATCAGTATTGCCCAGG - Intergenic
939928983 2:148208412-148208434 AAATTAAAATAAAATTGGCCTGG - Intronic
940022190 2:149167237-149167259 CCATTATGACAGAATGGCCCAGG + Intronic
940647204 2:156404221-156404243 AAATTAAAAAAAAATTACCCAGG + Intergenic
941086209 2:161121415-161121437 CAATTAAATCAGAATCTCCATGG + Intergenic
941497294 2:166221738-166221760 CAATTAAAATAGTATGGTCCTGG + Intronic
941593998 2:167452907-167452929 CAATCAAATCAGAATTCCCTGGG - Intergenic
941694703 2:168538515-168538537 CATTTAAAACAGATTGGCCAGGG - Intronic
941849380 2:170163797-170163819 CAATTAAATAAGAATTGCTGAGG + Intergenic
943287474 2:186021234-186021256 CAATTAAAACAGCATGGTACTGG - Intergenic
944106651 2:196085973-196085995 CACTGAAAACAGAATAGCTCTGG - Intergenic
944135650 2:196396814-196396836 CAATTAAAAAAAAAATGGCCGGG + Intronic
944410226 2:199433689-199433711 CTATTATTACAGAATTGCCCAGG + Intronic
944515004 2:200504161-200504183 TAATTTAAAAAGAATTGGCCGGG + Intronic
945778954 2:214143120-214143142 CAGTTAAAAAAGAAATGGCCAGG - Intronic
946813019 2:223546668-223546690 TAATTAAAACAGAGTGGTCCTGG + Intergenic
946894948 2:224314124-224314146 CCATCAAAACAGAGTTCCCCAGG + Intergenic
947508613 2:230729853-230729875 CAATAAAAAATGAAATGCCCAGG + Intronic
947867557 2:233410113-233410135 CAAAGAAAACAGCATTGGCCAGG - Intronic
1169304971 20:4481838-4481860 CAATTAAAAAACAGTTTCCCAGG + Intergenic
1169904465 20:10587616-10587638 CAAGCAAAACAGAATAGCACTGG + Intronic
1170075894 20:12418651-12418673 CAATTAAATCAGAATTTCTGTGG + Intergenic
1170087601 20:12552267-12552289 CAAAAAAAACAGACATGCCCTGG + Intergenic
1170215573 20:13887518-13887540 CAAGTAAAACAGAATTGTTTGGG + Intronic
1170495995 20:16925737-16925759 TAATTAAAACAGAACTGAGCTGG - Intergenic
1172086568 20:32388822-32388844 CAATAAAAACATACATGCCCAGG - Intronic
1172290224 20:33770683-33770705 CAATTAAAAAAGAATGGGCAGGG + Intronic
1173129292 20:40373284-40373306 CAACTAAAACCCAATTCCCCAGG + Intergenic
1173524713 20:43722829-43722851 CAATTAAAATTAAATTGGCCAGG - Intergenic
1173961052 20:47072859-47072881 CATTTAAAACAGAACCACCCTGG + Intronic
1173969200 20:47138180-47138202 CAAGTAACACAGTGTTGCCCTGG - Intronic
1174095720 20:48088059-48088081 CAATTAAAAGAGACATCCCCTGG + Intergenic
1174745983 20:53063685-53063707 AAATCAAAACTGATTTGCCCAGG + Intronic
1175468660 20:59210218-59210240 CAATTAAAACAGAATTGCCCCGG + Intronic
1175489068 20:59366446-59366468 CACTTAAAACACAAGTGGCCTGG - Intergenic
1175867963 20:62191508-62191530 GAATTAAAGCAGAATGGCCAAGG + Intronic
1177532008 21:22372742-22372764 CAATTAAAACAGTATTGTACTGG - Intergenic
1177532078 21:22373667-22373689 CAATTAAAACAGTATTGTACTGG + Intergenic
1180480746 22:15750885-15750907 CAATCAAAGCAGACTTTCCCTGG + Intergenic
1181183432 22:21083493-21083515 CAAACAAAAAAAAATTGCCCGGG - Intergenic
1181914267 22:26266752-26266774 CAATAGAAACAGAACTGACCTGG - Intronic
1182807818 22:33090401-33090423 TAATTTAAACAGAATTCTCCAGG + Intergenic
1183251544 22:36733749-36733771 GAATGAAAAGAGAATTGCTCAGG - Intergenic
1183271802 22:36866943-36866965 CAATTAAATCAGAATCTCCGGGG - Intronic
1184541666 22:45129835-45129857 ATACTAAATCAGAATTGCCCTGG + Intergenic
1184920387 22:47601368-47601390 CAATTAAAACAGAAGTGTAGAGG - Intergenic
949847471 3:8386466-8386488 AAATTGATACAGTATTGCCCAGG - Intergenic
949959212 3:9298299-9298321 CTATTAAAACATAATTACTCTGG + Intronic
950366162 3:12485595-12485617 CAATTACATCAGAATTTCCTGGG - Intronic
950586706 3:13897331-13897353 AAATTAAAACAGATGTGACCTGG + Intergenic
950638356 3:14332193-14332215 AAATTAAAACAAAATTGGCTGGG - Intergenic
951079236 3:18431532-18431554 CAATTAAATCAGAATGGCTGAGG + Intronic
953712514 3:45286478-45286500 CAATTAAATCAGAATATCCATGG - Intergenic
953892300 3:46760983-46761005 CAATTAAAAAAAATTTGACCGGG + Intronic
954103059 3:48392653-48392675 CAATTAAAACAGAGTATCCCTGG - Intronic
955276062 3:57548411-57548433 CAATTAAAATAGAAAAGGCCAGG + Intergenic
955692885 3:61607402-61607424 CCATTAAAACTGAAATGCCTGGG + Intronic
955972688 3:64451578-64451600 CAATTAAATCAGAATTTCAGGGG + Intergenic
956192306 3:66619785-66619807 GAATTAAAACACATTTTCCCAGG + Intergenic
956487003 3:69733563-69733585 CTATTAAATCAGAATTGCCAAGG - Intergenic
957104588 3:75870083-75870105 CAATTAAATCAGAATTTCAGAGG - Intergenic
959298952 3:104575127-104575149 TAATCAAAACAGCATGGCCCTGG - Intergenic
959868163 3:111295066-111295088 CAACTAAAACAGCATTGTACTGG - Intronic
960323645 3:116268015-116268037 AAATTATATCAGAATTGCCCTGG - Intronic
961108954 3:124267535-124267557 CAATTAAATCAGAATTTCTAGGG + Intronic
961335613 3:126177742-126177764 CAAGTATAACAAAATTGGCCAGG + Intronic
961409959 3:126713230-126713252 CAGTTAAAAAGGAGTTGCCCGGG + Intronic
962731700 3:138289651-138289673 CAATTAAATCAGAATCTCTCGGG + Intronic
963186208 3:142420187-142420209 TAATTAAAAAAAAATTGCCAGGG + Intronic
963250930 3:143102901-143102923 AAATTAAAAAAGAATGGACCGGG - Intergenic
964428100 3:156574389-156574411 CAATCAAGTCAGAATTGCCAGGG + Intergenic
965143273 3:164866029-164866051 CAATAAAAACAAAATTAGCCGGG + Intergenic
965867520 3:173223255-173223277 GATTTAAAACAGAATAGGCCTGG + Intergenic
966003163 3:174975382-174975404 CAAATAAGACAGAATTGTCATGG + Intronic
967291207 3:187922085-187922107 CAAATAAAACAGAATTCCCAAGG - Intergenic
967342584 3:188416420-188416442 AAAATAAAACAGAACTTCCCGGG + Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968777369 4:2551090-2551112 CAATTAAAAAATAAATGACCAGG - Intronic
969001247 4:3984069-3984091 CATCTAAAAAAGAATTGCCCAGG - Intergenic
969752766 4:9124630-9124652 CATCTAAAAAAGAATTGCCCAGG + Intergenic
969812672 4:9660793-9660815 CATCTAAAAAAGAATTGCCTAGG + Intergenic
970289222 4:14553295-14553317 CAATTACCACAGAAATACCCAGG + Intergenic
970516893 4:16841052-16841074 CAATCAAAACACAATTTCACAGG - Intronic
971042122 4:22765299-22765321 CAATAAAAGCAGAGGTGCCCTGG - Intergenic
972001844 4:34046852-34046874 CAACTGAACCAGAGTTGCCCTGG - Intergenic
972307636 4:37847255-37847277 CAAATAAAACAGTTTTCCCCTGG - Exonic
972585168 4:40431104-40431126 CAATTGAAAAAGAATTATCCAGG - Intronic
972767376 4:42163936-42163958 CAATTAACACAGAATTTCTGAGG + Intergenic
973716627 4:53683154-53683176 CAATTTAAATAGCATTGCCAGGG - Intronic
973797064 4:54438206-54438228 CAATTAAATCAGAATTTCTGGGG - Intergenic
975793445 4:77982092-77982114 CAATTAAAAAAAAATGGACCTGG - Intergenic
975814404 4:78202723-78202745 CAATTAAAACAGAATCCCAGAGG - Intronic
976656500 4:87494122-87494144 AAAGAAAGACAGAATTGCCCAGG - Exonic
979463523 4:121009964-121009986 AAATTAAATCAGGATTGTCCAGG + Intergenic
979495106 4:121374617-121374639 CAATTAAATCAGAATCTCCAGGG + Intronic
980570365 4:134608441-134608463 TAATTAAAAAATAATTGGCCAGG + Intergenic
981105283 4:140873959-140873981 CATTTAAAATAGAATAGGCCGGG - Intronic
981394315 4:144229326-144229348 CATTTAAAACATAAGTCCCCAGG + Intergenic
981875504 4:149539571-149539593 AAATAAAAAGAGAATTGGCCAGG + Intergenic
981962291 4:150555461-150555483 CAATACAAACAGAATTGGCTGGG + Intronic
982315691 4:154029339-154029361 CGATTAAAATAGAACTGCCTTGG + Intergenic
983174380 4:164571032-164571054 CAATTAAATCAGAATGCCCAGGG + Intergenic
984158583 4:176224096-176224118 CAATTTAAAAAGCATTGCCTGGG - Intronic
985021415 4:185694998-185695020 AAATTCAAGCAGAATTGGCCAGG - Intronic
986625256 5:9717615-9717637 CAATTAAAACAGAGTGGCACTGG + Intergenic
986942803 5:12975802-12975824 CATGCAAAACAGAATTTCCCAGG - Intergenic
987039429 5:14047764-14047786 CAATGAAAACATAAATTCCCTGG - Intergenic
988675564 5:33429452-33429474 TAATCAAAACAGCATGGCCCTGG - Intergenic
990796769 5:59551918-59551940 CTATTTAAAAAGAATTGGCCGGG + Intronic
991225274 5:64263253-64263275 CAATTAAAACAGCAGTGTGCTGG + Intronic
992719676 5:79548164-79548186 CAGTTAAACCAGAATTTCCAGGG - Intergenic
992739040 5:79754642-79754664 CAATTAAAAAAAAAATCCCCAGG - Intronic
993111532 5:83663035-83663057 CAAGTCAAACACAAATGCCCAGG + Intronic
993327049 5:86553446-86553468 AAATTAAAAAAGAATTAGCCAGG + Intergenic
993364528 5:87019786-87019808 CAATTAAAGCAGATTGTCCCTGG - Intergenic
993527526 5:88984721-88984743 CAGCTAAGACACAATTGCCCAGG - Intergenic
993644544 5:90446435-90446457 CAAACAAAACAGTATTGCACTGG + Intergenic
993830081 5:92745335-92745357 CAATTAAAACAGGAATGATCTGG + Intergenic
994058593 5:95447834-95447856 CAATTAAATCAGAATTCCTGGGG + Intronic
994323455 5:98420999-98421021 CAATTAAATCAGAATTGAGGCGG - Intergenic
996421402 5:123266930-123266952 CAATTAAAAACCAGTTGCCCAGG - Intergenic
996692345 5:126353895-126353917 CAATTAAAACAGAATCACCTGGG + Intergenic
996951222 5:129128148-129128170 CAATTAAATCAGAATCTCCTTGG - Intergenic
997120913 5:131171860-131171882 CAATAGAAACAGAATTGCTCAGG + Intronic
997154347 5:131537253-131537275 TAATTCAGACAGATTTGCCCAGG - Intronic
997326915 5:133029160-133029182 CAAAAAAAAAAGAATTACCCAGG + Intergenic
998791005 5:145766285-145766307 CCATTAAATCAGAATTTTCCTGG - Intronic
1002275294 5:178100549-178100571 CAAATAAAACAAAATTAGCCGGG - Intergenic
1002832705 6:837398-837420 CTATTAAATCAGAATTCCCAGGG - Intergenic
1003534225 6:6962158-6962180 CAAGTAAACCAGAATTCCCAAGG - Intergenic
1003797883 6:9625888-9625910 TAATCAAAACAGAATGGCACTGG - Intronic
1003803334 6:9696648-9696670 TAATTAAAACAGAATGGTACTGG + Intronic
1003859688 6:10311084-10311106 CAATTAAGACAAAATCGCCGTGG - Intergenic
1004370352 6:15047109-15047131 CAATTAAGACGGGATTGTCCTGG + Intergenic
1004802057 6:19159629-19159651 CAATTTAGACAGAATTGATCTGG - Intergenic
1005686006 6:28253652-28253674 CAATTAAATCAGAATGTCACAGG + Intergenic
1005790138 6:29291350-29291372 CAATGAACACATAAGTGCCCAGG - Intergenic
1006687510 6:35848620-35848642 TAATTAAAACAGCATGGTCCTGG + Intronic
1006862973 6:37185586-37185608 AAATTAAAAAACAATTGGCCGGG - Intergenic
1008222412 6:48871888-48871910 TAATTAAAACAGTATGGCACTGG - Intergenic
1008320461 6:50105842-50105864 AAATCAATACAGAATTGCCTAGG + Intergenic
1008348044 6:50453783-50453805 CATTTTAAACAGAATTCCCATGG - Intergenic
1008601777 6:53103246-53103268 AAATAAAAACAAAATTGGCCAGG + Intergenic
1009609173 6:65916787-65916809 CAATTAAAAAAAAATTAGCCAGG - Intergenic
1010233118 6:73553069-73553091 CAAATACATCAGAATTACCCAGG + Intergenic
1010564248 6:77389977-77389999 TAATCAAAACAGCATTGCACCGG - Intergenic
1013200050 6:107885768-107885790 CAATTAAAACTGTATGGCACTGG + Intronic
1013386552 6:109637612-109637634 CAGTTAAAACAGAATTTCTAGGG - Intronic
1013569631 6:111408722-111408744 AAATTAAAACAGAAATGCAGTGG + Intronic
1014316020 6:119865665-119865687 CAATTTAGACAGTTTTGCCCTGG - Intergenic
1014570683 6:123004220-123004242 AAAATAAAACAGAATTGTGCTGG - Intronic
1016222526 6:141692774-141692796 CAATTAAAACAAGATAGCACCGG + Intergenic
1016713614 6:147200299-147200321 TGATTAAAATAGAGTTGCCCAGG + Intergenic
1017235812 6:152116815-152116837 TAATTAAAACAGTAATGGCCAGG + Intronic
1020283825 7:6664795-6664817 CATTTAAAACAGAATTGAGTAGG - Intergenic
1021888781 7:25166589-25166611 AAATAAAAACAGGATTGGCCAGG + Intronic
1023106672 7:36769740-36769762 CAGTTAAAAAAAAATAGCCCAGG - Intergenic
1023273209 7:38489109-38489131 TAATTAAAACAGCATTGTCCTGG + Intronic
1023337030 7:39180965-39180987 CAATTAGAGCAGAATTGCTGGGG + Intronic
1024190150 7:46998076-46998098 CAATAAAAATAGAATTGCAATGG - Intergenic
1025659729 7:63550521-63550543 CAAAAAAAACAGAATGACCCTGG + Intergenic
1026603625 7:71797460-71797482 CAATGATATCAGAAATGCCCAGG + Intronic
1027935497 7:84596814-84596836 CAATCAAAACAGAATGGTACTGG + Intergenic
1027949798 7:84800608-84800630 CAATTAAATCAGAATTTCTAGGG - Intergenic
1029009744 7:97246520-97246542 TAATTAAAACAGCATGGCACTGG + Intergenic
1030170254 7:106594325-106594347 CAATTAAATCAGAATTTCAGGGG - Intergenic
1030257531 7:107527872-107527894 CAATTAAAACAGCATTTCTATGG + Intronic
1031012919 7:116542361-116542383 CAATTAAATCAGAATTTCTAGGG - Intronic
1032294476 7:130623437-130623459 CAATTAAAACAGCATGGTACTGG - Intronic
1032373235 7:131382067-131382089 AAATTAATACAGAAGTGCCTGGG + Intronic
1032638381 7:133736399-133736421 CAATTAAATCAGAATTTTTCAGG - Intronic
1032788305 7:135219519-135219541 CAATTAAATCAGAATCTCCCAGG + Intergenic
1033861097 7:145629165-145629187 CCATGAAAACAGCATTTCCCAGG - Intergenic
1034132301 7:148730970-148730992 CAATAAAAAAAAAATTGGCCAGG - Intronic
1034226271 7:149486206-149486228 AAATAAAAACAGCATTTCCCAGG + Intronic
1034330749 7:150280186-150280208 CAATTACATCAGAATCTCCCAGG + Intronic
1034667295 7:152829663-152829685 CAATTACATCAGAATCTCCCAGG - Intronic
1034745012 7:153516554-153516576 CATTTTAAACAGAATCCCCCAGG + Intergenic
1036874925 8:12465700-12465722 CATCTAAAAAAGAATTGCCCGGG - Intergenic
1037954738 8:23046722-23046744 TAATTAAAACAGCATGGCACGGG + Intronic
1039395326 8:37220649-37220671 CCATCAAAAAAGAATTGGCCTGG + Intergenic
1039401232 8:37271135-37271157 CATTGAAAGCAGAATCGCCCTGG + Intergenic
1041983285 8:63888897-63888919 CAATTAAAAGAGTTTTGCACTGG + Intergenic
1042547551 8:69964646-69964668 AAATTAAAACAGAATTGGGCTGG + Intergenic
1043987662 8:86713353-86713375 CAATTAAATCAGTATTGCTGGGG + Intronic
1044531848 8:93316369-93316391 CAACTAAAACAGACTTTCCCGGG - Intergenic
1045384639 8:101659638-101659660 AAATTAAAAGGGAATTGCCAAGG - Intronic
1046843557 8:118888829-118888851 CATTTAAAAAAGAATAGGCCAGG + Intergenic
1047025879 8:120824078-120824100 CAATTATAACACAATTGTACGGG + Intergenic
1047646908 8:126879077-126879099 CAATTAAAACAGAATGGATGGGG - Intergenic
1047907802 8:129491551-129491573 CAATTAAATCAGAATTTCTATGG + Intergenic
1048447202 8:134500198-134500220 CAATTAAAACCGACCTGCCTTGG + Intronic
1048771369 8:137898887-137898909 CTTTTAAAACAGAATTGGCAAGG + Intergenic
1050159013 9:2697757-2697779 GAATTAACACACAATTTCCCAGG + Intergenic
1051127362 9:13819658-13819680 TAATTAAAACAGCATAGTCCTGG - Intergenic
1051157348 9:14164826-14164848 CAATTAAATCAGAATAGCTGGGG - Intronic
1051317973 9:15863738-15863760 CAATAAAAACAGAAATGAACAGG - Intronic
1052893770 9:33728406-33728428 GAATGAAAACAGTATAGCCCAGG - Intergenic
1052959576 9:34283544-34283566 CAATTAAATCAGAATCCCTCAGG - Intronic
1055075350 9:72209362-72209384 AAATTACAAGAGAATTGCTCAGG - Intronic
1055086756 9:72322372-72322394 AAATGAGAATAGAATTGCCCTGG + Intergenic
1055114577 9:72592986-72593008 CTGTTAAAACAGTATTGCTCTGG + Intronic
1055704929 9:78988032-78988054 CATTTAAAACAAATTTGCCAAGG + Intergenic
1056225496 9:84490999-84491021 CTATTAAATCAGAATTTCTCAGG + Intergenic
1057453762 9:95189251-95189273 CAATAAAAACCTAACTGCCCTGG + Intronic
1057636344 9:96772548-96772570 CAATTAAAACAGAGTTGAATAGG + Intronic
1057940770 9:99281690-99281712 CAATTAAAAAAAAATTAGCCAGG - Intergenic
1058774330 9:108268952-108268974 CAATTAAATCAGAATCTCCGGGG - Intergenic
1060246005 9:121946773-121946795 CAATTAAACCAGAATTTCTGGGG - Intronic
1060251810 9:121992432-121992454 CGATTAAATCAGAATTGCTGAGG - Intronic
1060558569 9:124523479-124523501 CAATTAAACCAGAATTCTCCAGG + Intronic
1060686295 9:125616044-125616066 CAATTGAAACAGAAAAGTCCAGG + Intronic
1061456209 9:130699844-130699866 AAATTAAAAAAGAATTAGCCGGG + Intronic
1186070493 X:5814438-5814460 CATTTTAAAAAGAATTGGCCAGG + Intergenic
1186082643 X:5950108-5950130 CAATTAGAACACAGTTGCCCAGG + Intronic
1187195067 X:17075608-17075630 CAATTAAAACATAAATGTGCAGG - Intronic
1188097271 X:26040546-26040568 TAATTAAAACAGTATGGCTCTGG + Intergenic
1188165772 X:26861536-26861558 CAATTAAAACAGAATTGTTTTGG - Intergenic
1188387404 X:29577980-29578002 CAATTAAATCAGAATCTCCAGGG + Intronic
1189013954 X:37076756-37076778 CAAGTCAACAAGAATTGCCCAGG - Intergenic
1189236901 X:39494255-39494277 CAATTAAAACAGAATCTCTTGGG + Intergenic
1189618314 X:42808478-42808500 CAATTAAAAAAAAATTTCCATGG + Intergenic
1190367883 X:49714176-49714198 CATTTAAAAAAGAACTGGCCAGG - Intergenic
1191660510 X:63644924-63644946 CAATTAAAAAACAATTAGCCAGG - Intronic
1193944477 X:87717124-87717146 AAAATGAAAGAGAATTGCCCTGG + Intergenic
1194012460 X:88579604-88579626 CAACCAAAACAGAATTGCACTGG + Intergenic
1194537825 X:95128714-95128736 TAATTAAAACAGTATGGCACTGG + Intergenic
1196339018 X:114574207-114574229 TAATTAAAACAGTATGGCACAGG + Intergenic
1196566798 X:117216420-117216442 CAATTAAAACAGCATAGTACAGG + Intergenic
1196594635 X:117529955-117529977 CATTTTAAACAGAATTGACATGG - Intergenic
1196671549 X:118373497-118373519 CAATTAACACCTAATTGCCTTGG - Intronic
1197454753 X:126665163-126665185 AAATTAAATCAGAGCTGCCCTGG - Intergenic
1197501540 X:127248308-127248330 CATTTAAAACACAATTTCCTAGG - Intergenic
1198022582 X:132673703-132673725 CACTTAAAACAGACTCTCCCAGG + Intronic
1198688778 X:139257747-139257769 AAAATAATACAGAATTCCCCAGG - Intergenic
1199135792 X:144250688-144250710 AAATTAAAACAGAATTTGCCAGG + Intergenic
1199539923 X:148947444-148947466 CGATAAAAACAGAATTGCTGTGG - Intronic
1200752981 Y:6964022-6964044 CATCTAAAAAAGAATTGCCCAGG - Intronic
1202339120 Y:23842112-23842134 CACTTTAAAAGGAATTGCCCAGG + Intergenic
1202531646 Y:25827960-25827982 CACTTTAAAAGGAATTGCCCAGG - Intergenic