ID: 1175473471

View in Genome Browser
Species Human (GRCh38)
Location 20:59251272-59251294
Sequence TTTCTGGTGTCACCACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175473471_1175473474 -6 Left 1175473471 20:59251272-59251294 CCAGGCTGTGGTGACACCAGAAA 0: 1
1: 0
2: 2
3: 22
4: 187
Right 1175473474 20:59251289-59251311 CAGAAATAAAGAAGAGCCTCGGG 0: 1
1: 0
2: 3
3: 34
4: 389
1175473471_1175473473 -7 Left 1175473471 20:59251272-59251294 CCAGGCTGTGGTGACACCAGAAA 0: 1
1: 0
2: 2
3: 22
4: 187
Right 1175473473 20:59251288-59251310 CCAGAAATAAAGAAGAGCCTCGG 0: 1
1: 1
2: 2
3: 37
4: 465
1175473471_1175473475 -5 Left 1175473471 20:59251272-59251294 CCAGGCTGTGGTGACACCAGAAA 0: 1
1: 0
2: 2
3: 22
4: 187
Right 1175473475 20:59251290-59251312 AGAAATAAAGAAGAGCCTCGGGG 0: 1
1: 0
2: 2
3: 24
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175473471 Original CRISPR TTTCTGGTGTCACCACAGCC TGG (reversed) Intronic
901576401 1:10204595-10204617 TTACTGGTGGCATCACAGCTGGG + Intergenic
901733542 1:11297608-11297630 ATTCTGATCTCAGCACAGCCAGG - Intergenic
904916352 1:33973230-33973252 TTCCTGCTGTCAACACAGCTTGG - Intronic
909397473 1:75186622-75186644 TCACAGGTGTCACCACAGCAAGG + Intergenic
910654455 1:89605633-89605655 TGTCCGTTCTCACCACAGCCAGG + Intergenic
915542382 1:156576028-156576050 TTTAAGGTGCTACCACAGCCTGG - Intergenic
915921209 1:159977078-159977100 TTCCTAATCTCACCACAGCCTGG + Intergenic
916851159 1:168705423-168705445 TTTCTGGTGTCCCCACAAAGTGG - Intronic
917710627 1:177680590-177680612 TTTCTGGGTTGAGCACAGCCAGG + Intergenic
923091543 1:230744921-230744943 TTTCTGGTGACACCTCGGCAGGG - Intergenic
923147644 1:231209324-231209346 CTTCTGCTGTCCCCAAAGCCAGG + Intronic
1064455205 10:15481150-15481172 GTTCTGGGGTCAGCAGAGCCAGG - Intergenic
1064811542 10:19205171-19205193 TTTCTGGTGTCGCCACACCAGGG + Exonic
1065493030 10:26302033-26302055 TTTCTGGGCTCACCACATTCTGG - Exonic
1065562372 10:26976744-26976766 TTTCTCGTGGCACAGCAGCCAGG + Intergenic
1070591901 10:77807489-77807511 TTTCTGGTGTCCCCCAAGCCAGG - Intronic
1070803453 10:79256599-79256621 TTTCTTGTGAAACCACAGGCTGG - Intronic
1071083510 10:81840792-81840814 TTTCTGGACTCACCACAGAACGG + Intergenic
1071087906 10:81884845-81884867 TTAATGCTGTCACCACAGTCAGG + Intronic
1074193842 10:111162076-111162098 TCTCTGGTGTCACAACTACCTGG + Intergenic
1076593732 10:131610636-131610658 TTTCTTATGTAACCACAGCAGGG + Intergenic
1077142889 11:1032167-1032189 TGTCTGGGGTTTCCACAGCCTGG - Intronic
1077484204 11:2831449-2831471 CTTCTTGTGTCTCCACAGTCAGG - Intronic
1077536297 11:3126413-3126435 TTCCTGCTGTCCCCAGAGCCAGG + Intronic
1078101846 11:8334626-8334648 TTTCTGGTGTCAGCACGGCAGGG + Intergenic
1079321817 11:19457708-19457730 TTGCTGGTGACACCCCAGGCTGG - Intronic
1082784200 11:57307963-57307985 TGGCTGGGGCCACCACAGCCAGG - Intronic
1083209643 11:61175147-61175169 TTCCTGGTGCCACTCCAGCCGGG + Intergenic
1083463905 11:62832806-62832828 TATCTGATGTCACAAAAGCCGGG - Intronic
1083984964 11:66208041-66208063 TTACAGGTGCCACCACACCCAGG + Intronic
1084856778 11:71994339-71994361 TTTCTGGTGGAACCATAGTCTGG + Intronic
1086582933 11:88420394-88420416 TTTCTCGTCTCTCCACAGCCTGG - Intergenic
1086979732 11:93180843-93180865 TTTCTGGTGATAACACAGCTGGG - Exonic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1088580044 11:111306602-111306624 TTTCTGCTTTAACCAGAGCCTGG + Exonic
1089979299 11:122759087-122759109 TTTCTGGTGAGAACACGGCCTGG - Intronic
1091201978 11:133787972-133787994 AGTCTGTTGTCACCACAGCTGGG + Intergenic
1094085712 12:26589396-26589418 TTTCTGGAGTCAGCACTACCAGG - Intronic
1094415041 12:30207277-30207299 TTTCTGGTGTCTCCACTGTTGGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097921859 12:65084357-65084379 TGTTAGGTGTCTCCACAGCCTGG + Intronic
1100189602 12:92176669-92176691 TTCCTGTTGTCACAACTGCCAGG - Intergenic
1102281959 12:111625486-111625508 TTTCTTGTGTTCCCACAGCATGG + Intergenic
1102492377 12:113297074-113297096 TCTCTGGTGTGAGCAGAGCCAGG - Exonic
1102743916 12:115232962-115232984 TATCTGCTGTCATCACATCCAGG + Intergenic
1103538462 12:121649953-121649975 TTTTTGATGTCACAACAGGCAGG - Intergenic
1104736978 12:131141000-131141022 TTTCTGGGGTCACGGGAGCCTGG - Exonic
1107757003 13:43635291-43635313 CTTCTGGTGGCACCAAATCCCGG - Intronic
1108056308 13:46488977-46488999 TTTCTGGTGTCACAGGAGCTAGG - Intergenic
1110154116 13:72293284-72293306 TTTCTGAATTCCCCACAGCCTGG - Intergenic
1113552699 13:111205435-111205457 TTTCTTGTTTTACCAAAGCCAGG + Intronic
1117245541 14:53881323-53881345 TTTCTGGTGTCAGCTGAGCAGGG - Intergenic
1119156559 14:72417035-72417057 TTGCTGCTGCCACCACAGGCAGG + Intronic
1119798602 14:77422533-77422555 TTTATTATGTAACCACAGCCAGG + Intronic
1121148277 14:91605681-91605703 TATCTGGTGTTGCCTCAGCCTGG + Intronic
1123012945 14:105357992-105358014 CTCCTGGTCTCCCCACAGCCTGG - Intronic
1124577506 15:30922920-30922942 ATTCTGTGGCCACCACAGCCAGG + Intronic
1127982412 15:64045030-64045052 TTTCTTGTGTCAACTCAGGCAGG - Intronic
1128405727 15:67335848-67335870 TTCATGGTGTTACCACATCCTGG + Intronic
1128935381 15:71741954-71741976 TGTCTGGTGCCATCACCGCCTGG - Intronic
1131779937 15:95845244-95845266 TTTCTCCTGTCACCAAAGACAGG - Intergenic
1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG + Intergenic
1136024599 16:27461556-27461578 TGTCTGGTGTCTCCAGGGCCTGG - Exonic
1138781434 16:59793045-59793067 TTCCTGCTGTGAGCACAGCCAGG - Intergenic
1139538993 16:67599725-67599747 TTTATGGTGATACCACAGTCCGG + Intronic
1139921097 16:70461134-70461156 CTTCTGGTGGCAGCAGAGCCTGG + Intronic
1140856340 16:78981194-78981216 TTTCTGATGCTAACACAGCCAGG - Intronic
1142172099 16:88628232-88628254 TTGCAGGTGTCAGCACAGCCTGG + Intronic
1142282185 16:89154410-89154432 TCCCTGGTGTCACCTCTGCCTGG + Exonic
1142902562 17:3021341-3021363 TGACTGGTGTCACCAGAGGCTGG - Intronic
1145836327 17:27956785-27956807 TTGCTGGGGTGAGCACAGCCCGG + Intergenic
1145913252 17:28554774-28554796 TCTCTGGTCTCACCACACTCTGG + Intronic
1147923689 17:43933838-43933860 TACCTGGTGCCACCACAGCTGGG - Intergenic
1148590015 17:48809188-48809210 TTTATGGTGACACCAGAGCAGGG + Intronic
1150392471 17:64797996-64798018 TTGGAGGTGTCTCCACAGCCGGG + Intergenic
1152544817 17:80995161-80995183 TTTCTGATGTCCACGCAGCCGGG - Intronic
1156473358 18:37391066-37391088 TGTCTGGTGGCACCTCAGGCCGG - Intronic
1157409139 18:47449175-47449197 TTTCTGGTCTATCGACAGCCGGG - Intergenic
1157866928 18:51196268-51196290 TTTCTGGTGCCACGCCAGCCTGG + Intronic
1163591348 19:18195868-18195890 TGTCTGATGTGACCTCAGCCCGG + Intronic
1163646550 19:18492894-18492916 TTCCTGGTGTCATCGCAGCCTGG - Intronic
1164796975 19:31041323-31041345 TTTCAGGTGCCCCCAAAGCCTGG + Intergenic
1164932529 19:32186586-32186608 TTTCTGGTTTGTCCACAGGCAGG + Intergenic
926425309 2:12734310-12734332 TTTCTGGTACCACCACTTCCAGG + Intronic
928641251 2:33302323-33302345 TTTCTGGTTTCACAACTGACAGG - Intronic
928767969 2:34670737-34670759 TCTCTGTGGTCACCACAGCTGGG - Intergenic
929947809 2:46383528-46383550 TGTCTGGTGTTTCTACAGCCTGG - Intronic
931119215 2:59197892-59197914 TTCCTGGTGTCATCCCAGCCAGG + Intergenic
931998193 2:67859031-67859053 TTTCCAGGGTCACCACAGCAGGG - Intergenic
935456195 2:103270149-103270171 TTTCTATTGTCACCACAGATGGG + Intergenic
936937875 2:117855756-117855778 TTTCTTGTTTCTCCAAAGCCAGG + Intergenic
936989367 2:118346245-118346267 TGTGTGGTCTCTCCACAGCCTGG + Intergenic
937264325 2:120606590-120606612 GTTCTGGTGGCACCAGACCCAGG - Intergenic
942385727 2:175440869-175440891 TTTCTGGTACAACCAGAGCCAGG - Intergenic
942444630 2:176069926-176069948 TTTGTGGTGTGACCACAATCAGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
946313634 2:218896353-218896375 GTTCTGATCTCACCCCAGCCTGG - Intronic
947439755 2:230109072-230109094 TTGCTGTAGTCACCACAGCTGGG + Intergenic
948194626 2:236085973-236085995 TCTCTGCTGTTATCACAGCCTGG + Intronic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
948629045 2:239290302-239290324 TTCTGGGTGTCCCCACAGCCTGG - Intronic
1170596121 20:17807017-17807039 TTCCCGATGTCACCCCAGCCAGG - Intergenic
1172647967 20:36483377-36483399 TTCCTGGTTTCCCCCCAGCCTGG - Intronic
1172795178 20:37532084-37532106 TTGATGGTGTTTCCACAGCCTGG - Intergenic
1173703815 20:45095606-45095628 TTACTGGTGGCACCACAGCCAGG + Intronic
1174093611 20:48069709-48069731 TTTTTGGTGTCTCAACAGCCAGG - Intergenic
1174414150 20:50356284-50356306 CTTCTGTTTTCTCCACAGCCTGG - Intergenic
1175180624 20:57144147-57144169 GTTCTGGTTTCTCCACATCCTGG - Intergenic
1175473471 20:59251272-59251294 TTTCTGGTGTCACCACAGCCTGG - Intronic
1175918377 20:62438207-62438229 ATTCAGGTGTCTCCACACCCCGG - Intergenic
1176312262 21:5158394-5158416 TCTCTGATGTCCCCACGGCCAGG + Intergenic
1177073063 21:16535232-16535254 TTTCTAAAGTCAGCACAGCCTGG + Intergenic
1177868267 21:26538790-26538812 TTTTTGGTGTCATGGCAGCCTGG + Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1179844786 21:44103636-44103658 TCTCTGATGTCCCCACGGCCAGG - Exonic
1180260956 21:46668298-46668320 CTCCTGGTCTCACCACACCCAGG + Intergenic
1180912751 22:19464310-19464332 GTTCGGGAGTGACCACAGCCTGG - Intronic
1181338017 22:22155627-22155649 GTTCCTGTGTCACCACAACCTGG - Intergenic
1182415590 22:30219176-30219198 GTTCTGGTTTCTCCACATCCTGG - Intergenic
1184471650 22:44699342-44699364 TTTGTGGGCTCAGCACAGCCTGG - Intronic
1184805145 22:46790294-46790316 CTTCTGCTCTGACCACAGCCAGG + Intronic
949785397 3:7734635-7734657 TTTCTTGTGTCAACAAATCCAGG + Intronic
950343560 3:12271235-12271257 TTTCTTGTGTAACCACAATCCGG - Intergenic
950631272 3:14283671-14283693 TGTCAGCTGTCAGCACAGCCAGG - Intergenic
951015830 3:17731617-17731639 TGACTGGTGTCCCCGCAGCCAGG - Intronic
953149253 3:40309596-40309618 TTTCTGGAGGCAGCAGAGCCCGG - Intergenic
954422062 3:50424003-50424025 GGACTGGTGTCACCAAAGCCTGG + Intronic
955040882 3:55316670-55316692 TTCCTGGTATCACCACAGCAAGG - Intergenic
956654355 3:71534750-71534772 TTTAAGGGCTCACCACAGCCAGG + Intronic
961715655 3:128855753-128855775 CTTCTGGAGTCACCAGAGCAGGG + Intergenic
963676245 3:148315306-148315328 TTTCTGTGGCCACCACAGCTGGG - Intergenic
964919269 3:161876003-161876025 TTTGTGGTGTCACTACATTCAGG - Intergenic
966821082 3:183925041-183925063 TTTCAGGCGTTCCCACAGCCTGG - Intronic
967532804 3:190568354-190568376 TTTCTGGAGTCAAGGCAGCCTGG - Intronic
967662518 3:192130464-192130486 CTTCTGGTGTGCCCACATCCAGG - Intergenic
968657391 4:1784631-1784653 CTTCAGGTGGCAGCACAGCCTGG - Intergenic
975852360 4:78585269-78585291 ATGGTGGTGCCACCACAGCCTGG - Intronic
978276037 4:106951117-106951139 TTTTTGGTGTCACAAGAGGCAGG - Intronic
978419177 4:108511805-108511827 TTGCTGGTGGCAACACAGCATGG + Intergenic
980904919 4:138938999-138939021 CATCTGTTGTCACCACAGCACGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981564963 4:146090931-146090953 TTTCTGATGTCTCCACAGCAAGG - Intergenic
984312676 4:178083094-178083116 CTTCTGGTGTAACCACATCCCGG + Intergenic
984312779 4:178084230-178084252 TTTCTGGTGTAACCACATCCCGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
990460042 5:56022888-56022910 TTTCTGGTCACAGCACAGCAAGG + Intergenic
992749760 5:79851072-79851094 TCTCTGGCATCACCAGAGCCTGG + Intergenic
995625070 5:114067333-114067355 TTTCTGGTCTCACCCCAGACTGG + Intergenic
1002932602 6:1644707-1644729 TTTCTGGTGACCACAGAGCCAGG + Intronic
1005422800 6:25670293-25670315 TTTCAGGTTTCCCCACAGACTGG - Intronic
1006620487 6:35360573-35360595 TTGCTGATGTCACCTCAGCATGG + Intronic
1011160894 6:84389307-84389329 TTTCTGTTATTACCACCGCCTGG + Intergenic
1011432199 6:87299656-87299678 TTTCTGTTGTCACCAAAATCTGG - Intronic
1012854366 6:104484431-104484453 TTTCTGTTCTCTCCACAGGCAGG + Intergenic
1013944486 6:115705178-115705200 TTGCTGATGTCACTACAGCCTGG + Intergenic
1014295689 6:119614336-119614358 TTTCTGATGACACCACAGAGTGG + Intergenic
1018101227 6:160442327-160442349 TTCCTTGTGTCACCACCGCAAGG + Intronic
1018356244 6:163020898-163020920 TTGCTGTTGTCTCCAAAGCCTGG + Intronic
1018624275 6:165762700-165762722 TTTCTTATGTTACCACAGACTGG + Intronic
1018978599 6:168583968-168583990 TTACTGTTGCAACCACAGCCTGG - Intronic
1019612243 7:1942377-1942399 CTGCTGCTGTGACCACAGCCTGG + Intronic
1019714215 7:2530896-2530918 TTCCAGGTCTCAGCACAGCCTGG + Intergenic
1019746980 7:2706154-2706176 TTTGTGGGGTCAGCTCAGCCTGG + Intronic
1020000291 7:4751774-4751796 ATCCTGGTGTCACTCCAGCCGGG - Intronic
1022276590 7:28861346-28861368 TTCCTGGTATCATCACAGCAGGG - Intergenic
1023258779 7:38337606-38337628 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023259309 7:38342270-38342292 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023259767 7:38346591-38346613 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023260242 7:38350920-38350942 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023260750 7:38355740-38355762 TTTCTGCTGTCTTCACAGCTGGG + Intergenic
1023261219 7:38360071-38360093 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023261735 7:38364883-38364905 TTTTTGCTGTCATCACAGCTGGG + Intergenic
1026458514 7:70593802-70593824 GTTGTGGTCTCACCACAGTCAGG + Intronic
1026544733 7:71312047-71312069 TTTAGGGTGTTGCCACAGCCAGG - Intronic
1027108594 7:75420398-75420420 TTGCTGGGGTCTCCACAGCCGGG + Intronic
1027128430 7:75573570-75573592 TTACTGGGGTCACCAAAGCCTGG + Intronic
1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG + Intronic
1027432037 7:78124356-78124378 TCTCTGGTGTCAGCCCTGCCTGG + Intronic
1028903924 7:96132227-96132249 TCTCTGGTCTCACCAAAGACGGG + Intronic
1030176758 7:106661492-106661514 TTCCTGGTATCATCACAGCTAGG + Intergenic
1031350508 7:120724736-120724758 TTTCCGGTGGCTCCACAGCTGGG + Intronic
1031515306 7:122692025-122692047 TGTCTGGTGCCACCCAAGCCAGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037690217 8:21175538-21175560 TTTCTGGTATTACCCCATCCAGG + Intergenic
1041423488 8:57695023-57695045 GGTCGGGTGTCACCACACCCAGG + Intergenic
1041887766 8:62831329-62831351 TCTTTGGTGTCACCACATTCAGG - Intronic
1043657412 8:82686870-82686892 TTTATTGTGGCAACACAGCCAGG + Intergenic
1044485243 8:92744903-92744925 TTTCTTGTGACAGCCCAGCCTGG + Intergenic
1045169622 8:99650056-99650078 TTTCTGGTGCCAGCCCAGACTGG - Intronic
1046760535 8:118015771-118015793 TTGCAGCTGTCACCCCAGCCTGG + Intronic
1047786145 8:128155674-128155696 CTTCTGGTGTCACCTCCCCCAGG + Intergenic
1048816512 8:138339530-138339552 TTTCTGATGTCACGAAAGCATGG - Intronic
1048880995 8:138872426-138872448 TCTCTCCTGTCCCCACAGCCAGG - Intronic
1048961692 8:139584917-139584939 TTACAGGTGCCACCACACCCAGG - Intergenic
1049195879 8:141315400-141315422 TGTCTGGGGTCACCCCACCCAGG + Intergenic
1049458394 8:142707269-142707291 TTTCACGTGCCACCACAGCTCGG + Intergenic
1053462287 9:38280331-38280353 TTCCCAGTGTCACCACAGGCAGG + Intergenic
1056057352 9:82840668-82840690 TTCCTGGTGGCACCATATCCTGG + Intergenic
1057231748 9:93325484-93325506 TCTAAGGTCTCACCACAGCCTGG - Intronic
1057531919 9:95856572-95856594 TTTCTGGAGTCACCACCAGCTGG - Intergenic
1057790200 9:98119376-98119398 TTTCTGGTGGGACCACCTCCCGG - Intergenic
1058045324 9:100352275-100352297 TTTCTGGGGTCGCCCCTGCCTGG - Intronic
1059072596 9:111154429-111154451 TTGCTGTGTTCACCACAGCCTGG - Intergenic
1061477742 9:130880259-130880281 TTTCTGGTCTCAGGACAGGCTGG - Intronic
1062686652 9:137817072-137817094 CTGCAGGTGTCACCACAGCCTGG + Intronic
1187729157 X:22235109-22235131 GGTCTGGTGTCACCTCACCCAGG - Intronic
1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG + Intronic
1188834212 X:34936446-34936468 TTTATGGTGTCAACACATCGAGG + Intergenic
1192194865 X:69021433-69021455 TTTCTGGTGTTTCACCAGCCGGG - Intergenic
1196692829 X:118579028-118579050 TTTCTCGTTTCATCACAGACAGG - Intronic
1197561917 X:128034470-128034492 TTACTGTTGCCACCACAGCTGGG - Intergenic