ID: 1175474885

View in Genome Browser
Species Human (GRCh38)
Location 20:59265186-59265208
Sequence CTGAAGGGACAGATTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175474882_1175474885 14 Left 1175474882 20:59265149-59265171 CCTTGAGGGAGGCAGCTCTTTGC No data
Right 1175474885 20:59265186-59265208 CTGAAGGGACAGATTGCTGAAGG No data
1175474878_1175474885 30 Left 1175474878 20:59265133-59265155 CCTGAGAAAGTTGTGACCTTGAG No data
Right 1175474885 20:59265186-59265208 CTGAAGGGACAGATTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175474885 Original CRISPR CTGAAGGGACAGATTGCTGA AGG Intergenic
No off target data available for this crispr