ID: 1175474885 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:59265186-59265208 |
Sequence | CTGAAGGGACAGATTGCTGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1175474882_1175474885 | 14 | Left | 1175474882 | 20:59265149-59265171 | CCTTGAGGGAGGCAGCTCTTTGC | No data | ||
Right | 1175474885 | 20:59265186-59265208 | CTGAAGGGACAGATTGCTGAAGG | No data | ||||
1175474878_1175474885 | 30 | Left | 1175474878 | 20:59265133-59265155 | CCTGAGAAAGTTGTGACCTTGAG | No data | ||
Right | 1175474885 | 20:59265186-59265208 | CTGAAGGGACAGATTGCTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1175474885 | Original CRISPR | CTGAAGGGACAGATTGCTGA AGG | Intergenic | ||
No off target data available for this crispr |