ID: 1175479204

View in Genome Browser
Species Human (GRCh38)
Location 20:59299942-59299964
Sequence AGCCATCTGCACAGGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175479204_1175479209 -10 Left 1175479204 20:59299942-59299964 CCACCCAACCTGTGCAGATGGCT No data
Right 1175479209 20:59299955-59299977 GCAGATGGCTGAGGAAGCCCTGG No data
1175479204_1175479210 0 Left 1175479204 20:59299942-59299964 CCACCCAACCTGTGCAGATGGCT No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data
1175479204_1175479213 14 Left 1175479204 20:59299942-59299964 CCACCCAACCTGTGCAGATGGCT No data
Right 1175479213 20:59299979-59300001 CACCACAGGACCGCTAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175479204 Original CRISPR AGCCATCTGCACAGGTTGGG TGG (reversed) Intergenic
No off target data available for this crispr