ID: 1175479205

View in Genome Browser
Species Human (GRCh38)
Location 20:59299945-59299967
Sequence CTCAGCCATCTGCACAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175479205_1175479210 -3 Left 1175479205 20:59299945-59299967 CCCAACCTGTGCAGATGGCTGAG No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data
1175479205_1175479213 11 Left 1175479205 20:59299945-59299967 CCCAACCTGTGCAGATGGCTGAG No data
Right 1175479213 20:59299979-59300001 CACCACAGGACCGCTAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175479205 Original CRISPR CTCAGCCATCTGCACAGGTT GGG (reversed) Intergenic
No off target data available for this crispr