ID: 1175479210

View in Genome Browser
Species Human (GRCh38)
Location 20:59299965-59299987
Sequence GAGGAAGCCCTGGACACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175479201_1175479210 17 Left 1175479201 20:59299925-59299947 CCGACTCTCACCTGAAGCCACCC No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data
1175479208_1175479210 -8 Left 1175479208 20:59299950-59299972 CCTGTGCAGATGGCTGAGGAAGC No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data
1175479205_1175479210 -3 Left 1175479205 20:59299945-59299967 CCCAACCTGTGCAGATGGCTGAG No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data
1175479206_1175479210 -4 Left 1175479206 20:59299946-59299968 CCAACCTGTGCAGATGGCTGAGG No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data
1175479204_1175479210 0 Left 1175479204 20:59299942-59299964 CCACCCAACCTGTGCAGATGGCT No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data
1175479202_1175479210 7 Left 1175479202 20:59299935-59299957 CCTGAAGCCACCCAACCTGTGCA No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data
1175479200_1175479210 18 Left 1175479200 20:59299924-59299946 CCCGACTCTCACCTGAAGCCACC No data
Right 1175479210 20:59299965-59299987 GAGGAAGCCCTGGACACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175479210 Original CRISPR GAGGAAGCCCTGGACACCAC AGG Intergenic
No off target data available for this crispr