ID: 1175479837

View in Genome Browser
Species Human (GRCh38)
Location 20:59302856-59302878
Sequence CCCCATGAAAGCTGCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175479837_1175479839 3 Left 1175479837 20:59302856-59302878 CCTTGGTAGCAGCTTTCATGGGG 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1175479839 20:59302882-59302904 ACTTACCTACCTTGTGTCATCGG No data
1175479837_1175479843 30 Left 1175479837 20:59302856-59302878 CCTTGGTAGCAGCTTTCATGGGG 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1175479843 20:59302909-59302931 TCAAAAATGAAGTGCAGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175479837 Original CRISPR CCCCATGAAAGCTGCTACCA AGG (reversed) Intronic
904386989 1:30149410-30149432 CCCCATGAAAGTTGATGCCCTGG - Intergenic
904967970 1:34394233-34394255 CCCCATGCAAGCTGAAATCAAGG - Intergenic
905592275 1:39174729-39174751 CCCCAGGAAAGCTTGAACCAAGG + Intronic
905801357 1:40845403-40845425 GACCGTGATAGCTGCTACCACGG + Intergenic
910083525 1:83371524-83371546 GCCCATGAAAGCAGCCAGCAGGG - Intergenic
910375903 1:86570146-86570168 CCCTAAGAAAGCTGGTATCAGGG - Intronic
910488591 1:87743296-87743318 CCCCATGAGAGCTACTGCCTGGG - Intergenic
911880861 1:103236690-103236712 GCCCATGAAAGCAGCTAGGAGGG + Intergenic
912035196 1:105303250-105303272 CCTCATGAAAACTGCTACAGAGG - Intergenic
918734247 1:188038226-188038248 GCCCATGAAAGCAGCTAGGAGGG + Intergenic
918963335 1:191307158-191307180 CCCCATCACAGCAGCTCCCAGGG + Intergenic
920306577 1:205022035-205022057 GCCCATGCAAGCTGCCACCCTGG + Exonic
921053103 1:211524979-211525001 CCCCATTGCAGCTGCTGCCAAGG - Intergenic
1068805728 10:61192290-61192312 GCCCATGAAAGCAGCTAGGAGGG - Intergenic
1069882238 10:71600853-71600875 CCCCAGGAACTCTGATACCATGG - Intronic
1071741977 10:88369518-88369540 CCCCATGAGAGTTGGAACCAGGG - Intronic
1073540995 10:104316048-104316070 TCCCAGGAAAGCTCCAACCATGG - Exonic
1074803964 10:117029022-117029044 GCCCATGAGAGCAGCCACCAAGG + Intronic
1079147554 11:17867488-17867510 ACCCATGAAAGCAGCTAGGAAGG - Intronic
1081175505 11:39922453-39922475 GCCCATGAAAGCAGCCAGCAGGG + Intergenic
1082699511 11:56410191-56410213 GCCCATGAAAGCAGCTGCGAGGG + Intergenic
1085818899 11:79771032-79771054 GCCCATGAAAGCAGCTACAGGGG + Intergenic
1086323214 11:85671792-85671814 GCCCATGAAAGCTGCCAGGAGGG - Intronic
1088014079 11:105037912-105037934 ACCCATGAAAGCAGCTAGGAGGG + Intergenic
1092956376 12:13554264-13554286 GCCCATGATAGCTGCCACTAGGG + Exonic
1096496360 12:52041610-52041632 CCCCAGGCAATCTGCTTCCAGGG - Intronic
1097657096 12:62378992-62379014 CTCCATGAAAGCAGGTACCAGGG - Intronic
1097735853 12:63179897-63179919 GCCCATGAAAGCAGCTAGGAGGG + Intergenic
1098792133 12:74837244-74837266 CCTCGTGAAAGCAGCTAGCAAGG + Intergenic
1099536865 12:83855998-83856020 TCCCATGAAAGCAGCTAGGAAGG + Intergenic
1099675530 12:85755906-85755928 GCCCATGAAAGCAGCAACCAAGG + Intergenic
1100163341 12:91887612-91887634 CCCCTTGAAAACTGATAACAAGG - Intergenic
1104218198 12:126755593-126755615 CCCCTCGAAAGCTACTTCCATGG - Intergenic
1105396813 13:20043932-20043954 CCCCATCATAGCTTCTACCCTGG - Intronic
1106048222 13:26165543-26165565 ACCCATGAAAGCAGCTAGGAGGG + Intronic
1106618946 13:31355639-31355661 GCCCATGAAAGCTGCTGGGAAGG + Intergenic
1106942841 13:34796301-34796323 GCCCATGAAAGCAGCTAGCAGGG + Intergenic
1109437390 13:62323584-62323606 GGCCATGAAAGCTGTTTCCATGG - Intergenic
1109576341 13:64263922-64263944 CCCCATGAAAGCAGCTAGGAGGG + Intergenic
1111641913 13:90980014-90980036 GCCCATGAAAGCAGCTACGGGGG - Intergenic
1111847130 13:93525074-93525096 TCCCATGGAAGCTGCAAGCATGG + Intronic
1112742903 13:102495318-102495340 GCCCATGAAAGCAGCTACAGGGG - Intergenic
1113698434 13:112365140-112365162 CACCAGCAATGCTGCTACCAGGG + Intergenic
1115404209 14:32996972-32996994 GCCCATGAAAGCAGCTAGGAGGG + Intronic
1120712712 14:87809499-87809521 CCCCTTGGAATCTGGTACCAAGG - Intergenic
1133306644 16:4813719-4813741 CCCAAGGAAGGCTGCTACCTGGG + Exonic
1133597246 16:7304503-7304525 CCCCAGGAAAGCAGCCACCGAGG - Intronic
1140760192 16:78102749-78102771 CCCCATGACATCTGCAACCTGGG - Intronic
1141385038 16:83614304-83614326 CCCCAGGAAAGCTGCATCCGAGG - Intronic
1142023062 16:87796013-87796035 CCCCAGGGTAGCTGCTGCCAGGG + Intergenic
1142788471 17:2244294-2244316 CCCCCTGACAGCTGCACCCAGGG + Intronic
1148900598 17:50873222-50873244 CACCATGGAAGCTGCCACCATGG + Intergenic
1148900601 17:50873237-50873259 CACCATGGAAGCTGCCACCAAGG + Intergenic
1149223636 17:54443200-54443222 TGCCATGAAAGTTGGTACCATGG + Intergenic
1155910169 18:31497616-31497638 CCTCAGGAAAGCTGCGACCGCGG - Intergenic
1158082760 18:53613996-53614018 CCCCATGAAAGCTCCTGCAAAGG + Intergenic
1159617584 18:70599000-70599022 GCCCATGAAAGCAGCCAGCAGGG + Intergenic
1159765274 18:72481179-72481201 GCCCATGAAAGCAGCTAGGAGGG + Intergenic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1164512888 19:28911906-28911928 TCCCATCAAGGCTGCTACCCTGG + Intergenic
1164733258 19:30521536-30521558 CCTCCTGGAAGCTGCTACCCAGG + Intronic
927502383 2:23591378-23591400 CCACATGACAGCTGCTTCCTGGG + Intronic
927522445 2:23707582-23707604 CCCCATAAAAGCTGTGCCCAAGG + Exonic
928626366 2:33143566-33143588 CTCCATGTAAATTGCTACCAGGG - Intronic
928797575 2:35040627-35040649 GCCCATGAAAGCAGCCACGAGGG + Intergenic
930558443 2:52929579-52929601 GCCCATGAAAGCAGCTAGGAGGG - Intergenic
936096777 2:109536252-109536274 GCCCATGAAAGCAGCCACGAGGG + Intergenic
936607925 2:113976345-113976367 CCCCACGAAGGCTGCGACCTTGG - Intergenic
937774187 2:125756340-125756362 CCCAATGAGAGATGTTACCAAGG + Intergenic
938682653 2:133707249-133707271 CCCCATAAAAGCTGCTCCTTTGG - Intergenic
939869830 2:147514722-147514744 GCCCATGACAGCTGCTGCCCAGG + Intergenic
940661813 2:156554546-156554568 CCCCTAAAAAGCTGCTATCATGG - Intronic
940783577 2:157958953-157958975 GCCCATGAAAGCAGCTAGGAGGG - Intronic
943150541 2:184107104-184107126 CCCCATTATTGCTGCTACCAGGG - Intergenic
944551102 2:200845419-200845441 CCCCACCAAAGCTGCCCCCAAGG + Intergenic
944679552 2:202064707-202064729 GCCAATGAAAGCTGTTGCCAGGG + Intergenic
945333234 2:208562848-208562870 GCCCATGAAAGCAGCTAGGAGGG - Intronic
945661658 2:212693409-212693431 CCATATGTATGCTGCTACCAGGG + Intergenic
946153821 2:217794016-217794038 CCCCATAAAAGCTGGAGCCATGG + Intergenic
948946410 2:241222618-241222640 CTCCATGAAAACTATTACCAGGG - Intronic
1169245654 20:4022526-4022548 CCCCAAGAAAGCTGAAACCCAGG + Intergenic
1170499581 20:16960987-16961009 GCCCATGAAAGCAGCCAGCAGGG - Intergenic
1174219086 20:48937939-48937961 AACCATGAAAGCTACAACCACGG - Intronic
1175479837 20:59302856-59302878 CCCCATGAAAGCTGCTACCAAGG - Intronic
1175660010 20:60804350-60804372 CCCCATCCATGCTGCTACAAAGG + Intergenic
1180177447 21:46097713-46097735 CCCCAGGGCAGCTGCTACCAAGG + Intergenic
1182422585 22:30255880-30255902 CCCCAGGAAAGCTGGGCCCAGGG + Intergenic
1182921720 22:34086378-34086400 CCAAATGAAAGCTGCTTTCATGG - Intergenic
1183359591 22:37376597-37376619 CCCCATGGAAGCTGAGACAAGGG - Intronic
1184972733 22:48038112-48038134 CCGCATGAGGGCTGCTACAAGGG - Intergenic
951452158 3:22852075-22852097 GCCCATGAAAGCAGCCACGAGGG - Intergenic
951817947 3:26775993-26776015 GCCCATGGGACCTGCTACCATGG + Intergenic
951883814 3:27504741-27504763 CCCCAGGAATGAAGCTACCAGGG - Intergenic
952077934 3:29720928-29720950 CCAAATGAAAGCTGTTACCCTGG + Intronic
953143213 3:40248680-40248702 CTCCATCAAAACTGCTTCCAGGG + Intronic
954054885 3:48014397-48014419 CCCCTTGAAAGGTGCTACTATGG + Intronic
956068177 3:65418917-65418939 ACCCATGAGTGCTGCTACAATGG + Intronic
958692505 3:97485550-97485572 CCCTCTGAAAGCTGCCACAAGGG + Intronic
959644672 3:108684337-108684359 CACCAAGAAAGCTTTTACCAGGG - Exonic
960856012 3:122102883-122102905 CCCTATGACTGCTGCTCCCATGG - Intronic
965310107 3:167116483-167116505 CCCCATGGCAGCGGCTCCCAGGG + Intergenic
967566612 3:190980294-190980316 GCCCATGAAAGCAGCTGACAGGG + Intergenic
967952059 3:194848707-194848729 CCATATGAAAACTGCCACCATGG + Intergenic
969375416 4:6760484-6760506 CCCCATGAAGGCTGCTGCCTTGG + Intergenic
969501433 4:7555882-7555904 CCCCAGGAAAGCTGTTCACAGGG + Intronic
970678216 4:18477069-18477091 CCCCATCCAAGCTGCTTTCATGG + Intergenic
973554721 4:52071688-52071710 CCCCATGCAAGCTGCAGACATGG + Intronic
974202749 4:58662648-58662670 CCCCATGAAAGCAGCTGGGAGGG - Intergenic
976505136 4:85837624-85837646 CCCCATGAGAACTGCAACCTCGG - Intronic
979078443 4:116303963-116303985 CCCCATGAAAGCTGCCAGGAGGG + Intergenic
979580643 4:122355000-122355022 CCCCATGAGAACAGTTACCATGG + Intronic
980202816 4:129677573-129677595 GCCCATGAAAGCAGCCACGAGGG + Intergenic
982854318 4:160362198-160362220 GCCCATGAAAGCAGCTAGGAGGG - Intergenic
983900515 4:173128591-173128613 CCCCAGGGAAGCTGGGACCACGG - Intergenic
984567297 4:181346470-181346492 CCCCTTGGAAGCAGCCACCACGG + Intergenic
985930586 5:3054359-3054381 CCCCAAGAAAGAGGCTTCCAAGG - Intergenic
986796096 5:11213423-11213445 CACAAAGAAAGCTGTTACCAGGG + Intronic
987000113 5:13651720-13651742 GCCCATGAAAGCTGCCAGGAAGG + Intergenic
987999326 5:25330017-25330039 GCCCCTGAGAGCTGCTACAATGG + Intergenic
991178900 5:63725677-63725699 CCTCATGAAACCTGCAATCATGG + Intergenic
991736263 5:69633009-69633031 CCCCTTGACAGCTGCAAGCAGGG + Intergenic
991812759 5:70488648-70488670 CCCCTTGACAGCTGCAAGCAGGG + Intergenic
991815719 5:70509125-70509147 CCCCTTGACAGCTGCAAGCAGGG + Intergenic
996338971 5:122415243-122415265 GCCCATGCAGGCTCCTACCATGG - Intronic
997206522 5:132053546-132053568 CCCCAGGGAAGCTGCCACCTGGG - Intergenic
1000052042 5:157571817-157571839 GCCCATGAATACTGCTCCCATGG + Intronic
1002922492 6:1582396-1582418 CCCCAGGAAGGCAGCTGCCATGG - Intergenic
1003259735 6:4506450-4506472 GCCCATGAAAGCAGCTGCAAGGG - Intergenic
1003993258 6:11510129-11510151 CACCAAGAAAGCTGCAACTAGGG - Intergenic
1005655219 6:27928849-27928871 GCCCATGAAAGCAGCTAGGAGGG - Intergenic
1006629709 6:35422320-35422342 CAGCATGAAAGCTACTGCCAAGG + Intronic
1007889347 6:45271801-45271823 CCCCATGAAAGCAGCTGGGAGGG + Intronic
1007944535 6:45813732-45813754 CCACAGGGAAGTTGCTACCAAGG + Intergenic
1008053986 6:46927762-46927784 CTCTATGAAAGCTGGTACCTAGG - Intronic
1009346148 6:62614617-62614639 GCCCATGAAAGCTGCCAGGAGGG + Intergenic
1012169889 6:96003416-96003438 CCCCACCACAGCTGGTACCATGG + Intergenic
1013074009 6:106754562-106754584 CCCCATTAAGGCTGCATCCATGG + Intergenic
1013214520 6:108015350-108015372 CCCCATGAAAGCAGCCAGGAGGG - Intergenic
1015996335 6:138998705-138998727 CCCCATGGAAGCTGCTGACCAGG + Intergenic
1016579762 6:145616615-145616637 GCCCATGAAAGCAGCCAGCAGGG + Intronic
1019919818 7:4156410-4156432 CTCCATTAAAGCTGGGACCAAGG + Intronic
1021530502 7:21639380-21639402 CCCTAGGAAAGCTGCTAACCAGG - Intronic
1022352346 7:29577892-29577914 GCCCATGAAAGCAGCTAGGAGGG + Intergenic
1024172588 7:46805422-46805444 CTGCATGAAAGCTGCTCCAATGG - Intergenic
1024522665 7:50319745-50319767 GTCCATGAAAGCTGCTACTGGGG - Intronic
1025078403 7:55962871-55962893 AACCATGAAAACTGCAACCAAGG - Intronic
1026502379 7:70953699-70953721 CCCCAGGAAAGTTACAACCATGG + Intergenic
1027300356 7:76827665-76827687 GCCCATGAAAGCAGCCAGCAGGG - Intergenic
1028493705 7:91441472-91441494 GCCCATGAAAGCAGCTAGGAGGG + Intergenic
1028891030 7:95988794-95988816 CACCATGATAGCTGCTATGAAGG + Intronic
1030225753 7:107148384-107148406 CCCCATTAAAGTTTCTACAAGGG - Intronic
1030510852 7:110480720-110480742 GCCCATGAAAGCAGCTAGGAAGG - Intergenic
1030527597 7:110672855-110672877 CCCCATGAAAGCAGCCAGAAGGG - Intronic
1032858876 7:135859086-135859108 CCCCATGGCAGCAGCTCCCAGGG + Intergenic
1037178675 8:15976472-15976494 CCCCAAGAAGGGTGGTACCATGG + Intergenic
1041389948 8:57339296-57339318 CCCCATGAAACCAGCTACAGAGG - Intergenic
1044072929 8:87784917-87784939 TCCCATGAAAGCAGCTAGGAGGG - Intergenic
1044326952 8:90869431-90869453 GCCCATGAAAGCAGCTACAGGGG + Intronic
1045836482 8:106527288-106527310 CTCCATGAGAGCAGGTACCATGG - Intronic
1048225595 8:132582124-132582146 GCCCATTAAAGCTGCTCACAGGG - Intronic
1049252604 8:141597245-141597267 CCCCATCAGAGTTGCTCCCAGGG + Intergenic
1050288689 9:4130906-4130928 GCCCATGAAAACAGCTGCCAGGG + Intronic
1052351715 9:27465422-27465444 GCCCATGAAAGCAGCCAGCAGGG - Intronic
1052901868 9:33800294-33800316 ACCCATGGGAGCTGGTACCAAGG + Intergenic
1053025587 9:34725890-34725912 TCCCATGAAAGTGGCAACCAGGG + Exonic
1053037115 9:34834952-34834974 TCCCATGAAAGTGGCAACCAGGG + Intergenic
1053164113 9:35832703-35832725 CCTCCTCAAAGCTGGTACCAGGG - Intronic
1057960847 9:99455213-99455235 GCCAATGAAAGCTGGTACAAGGG - Intergenic
1060406862 9:123377119-123377141 ACCCAAGGAAGCTGCTTCCAGGG + Exonic
1062395731 9:136351890-136351912 CCCCATACAGGCTGCCACCAGGG - Intronic
1186323949 X:8458723-8458745 GCCCATGAAAGCAGCTAGGAGGG - Intergenic
1187456795 X:19448248-19448270 ACCCATGTAAGTTGCTACCAGGG - Intronic
1187994054 X:24906346-24906368 CCCCATCCAAGTTGCTACAAAGG - Intronic
1188378636 X:29464771-29464793 CTACATGAATGCTGCTACAAAGG - Intronic
1188991859 X:36830598-36830620 CCCCATGAAACCTGCTGTGAGGG + Intergenic
1190269618 X:48852606-48852628 GCCCATGAAAGCTGCTGGGAAGG - Intergenic
1190322415 X:49186795-49186817 CCCGATGAATGCTGCAACAATGG + Intergenic
1190856551 X:54300833-54300855 CCCCATGAAAATTTCTACTAAGG + Intronic
1192689734 X:73349636-73349658 CCCCATGAAAGCAGCTTGGAGGG + Intergenic
1195228606 X:102823428-102823450 ACCCATGAGAGCTGCTGCAAGGG - Intergenic
1196177255 X:112652735-112652757 CCTCATTAAAGCTGGCACCAAGG + Intronic
1199420392 X:147637452-147637474 GCCCATGAAAGCAGCCACGAGGG + Intergenic
1200062521 X:153489913-153489935 CCCCATAATAGCTGCCACCATGG + Intronic
1200916448 Y:8575412-8575434 TCCCATTACAGCTGCTAACAAGG + Intergenic