ID: 1175481657

View in Genome Browser
Species Human (GRCh38)
Location 20:59315482-59315504
Sequence ATGAACATGTTCTATTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175481654_1175481657 21 Left 1175481654 20:59315438-59315460 CCGAGGAAGCAGATCATCAACTT 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1175481657 20:59315482-59315504 ATGAACATGTTCTATTTGTTGGG 0: 1
1: 0
2: 2
3: 37
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175481657 Original CRISPR ATGAACATGTTCTATTTGTT GGG Intronic
903234830 1:21943166-21943188 ATAAACACGTTCTATGTGTCAGG + Intergenic
903280374 1:22246826-22246848 ATTCACATGTTTTATTTCTTAGG - Intergenic
903759710 1:25689445-25689467 ACGAACAGGTTCTATTTGTCAGG - Intronic
909240843 1:73211099-73211121 GAGAACATGTACTATTTGGTTGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909911161 1:81259480-81259502 ATGAACATGATCTACATGCTGGG - Intergenic
909957554 1:81799447-81799469 AAGAACATGTTCTAGTTATTTGG + Intronic
910358022 1:86382764-86382786 ATTAAGATGTTATATTTGATAGG + Intronic
910575716 1:88761136-88761158 AAGAACATGTCCTTGTTGTTAGG + Intronic
910603468 1:89056541-89056563 ATGAAAATTTTCTTTGTGTTTGG + Intronic
912271368 1:108212574-108212596 AAAAATTTGTTCTATTTGTTGGG + Intergenic
912423371 1:109563732-109563754 ATGGACATATTTTAGTTGTTAGG + Intronic
915500619 1:156314126-156314148 TTCATCATGTTCTCTTTGTTGGG - Intronic
916832314 1:168505560-168505582 ATGAAAATGTTTTATTTTTTTGG + Intergenic
916840702 1:168597650-168597672 GTGCACATCTTCTAGTTGTTAGG + Intergenic
916968460 1:169980624-169980646 ATGAAAATGTTCTATATATGTGG - Intronic
917523927 1:175770543-175770565 ATGATCATGTGCTATGTGTGAGG + Intergenic
918590596 1:186236796-186236818 ATGAACATGATCTGTCTGCTTGG + Intergenic
918900784 1:190414107-190414129 ATGACCATGTTTTATTTTTCTGG + Intronic
921223176 1:212988900-212988922 ATGAACATTTACTATTGGTGAGG - Exonic
921398127 1:214690481-214690503 ATGAACATGTTCTACATCTGTGG - Intergenic
921593744 1:217032772-217032794 ATGAAAATATTCTCATTGTTTGG + Intronic
921857543 1:220002962-220002984 GTGAACATGTTATTTTTCTTTGG + Intronic
923204465 1:231744654-231744676 ATGAACTTTTGCTATTTGTTGGG - Intronic
924272812 1:242351254-242351276 TTGAACACCTTCTATTTGTTAGG - Intronic
924402526 1:243701286-243701308 ATCAACATGATCTATTTGTGAGG - Intronic
924812686 1:247416980-247417002 ATGAACAAGTTGGCTTTGTTTGG - Intronic
1062874958 10:935627-935649 ATACACATGCTGTATTTGTTTGG - Intergenic
1063336168 10:5216685-5216707 ATAAACATTTTCTACTTCTTTGG + Intronic
1063582974 10:7325805-7325827 ATGAAAATGTTCTAATGTTTTGG + Intronic
1063690810 10:8285268-8285290 ATGAATTTGTTTTAGTTGTTGGG + Intergenic
1063873843 10:10450833-10450855 ATGGACATGATTCATTTGTTAGG + Intergenic
1064887866 10:20132275-20132297 ATGCACATGGAATATTTGTTAGG - Intronic
1065394622 10:25221206-25221228 TTGAATATGTTATATTTGTGTGG + Intronic
1066014650 10:31228591-31228613 ATGAATGTGTCCTATTTTTTTGG + Intergenic
1066711903 10:38245410-38245432 TTGAACACCTTCTATTTGTTAGG + Intergenic
1067513851 10:46919850-46919872 ATTAATATGTTGTGTTTGTTTGG + Intronic
1067648403 10:48131984-48132006 ATTAATATGTTGTGTTTGTTTGG - Intergenic
1067986672 10:51155338-51155360 AAAAGCATGTTCTATGTGTTGGG - Intronic
1068749699 10:60577789-60577811 AGAAACATGTTCTATATATTAGG + Intronic
1069133766 10:64738379-64738401 ACAAACATGTTCTACTTGTGAGG + Intergenic
1069548132 10:69343309-69343331 TTGAACTTGTCCTATATGTTAGG + Intronic
1071088483 10:81891987-81892009 ATGAAGATTTTGTTTTTGTTTGG + Intronic
1071351137 10:84746692-84746714 ATGATCATGTTATATATTTTTGG + Intergenic
1071379132 10:85040147-85040169 AAGAATATGTGCTATTTGGTCGG + Intergenic
1071813846 10:89211058-89211080 AACTACATGTTCTATTTGCTGGG - Intergenic
1073357152 10:102865734-102865756 ATGATCATTTTCTATATTTTGGG - Intronic
1073530612 10:104228739-104228761 ATGTATATGTTCTAATTGTATGG + Intronic
1073835471 10:107436181-107436203 ATGATCATGTACAATTTGCTGGG + Intergenic
1074666236 10:115728807-115728829 GTGTATATCTTCTATTTGTTGGG + Intronic
1074718770 10:116246822-116246844 ATGCACATTTTATATTTTTTTGG - Intronic
1077854847 11:6113582-6113604 ATTAACATGCTCTGTTTGGTGGG - Intergenic
1077948775 11:6931546-6931568 ATGAAAAGTTTATATTTGTTAGG - Intronic
1079151098 11:17899983-17900005 ATGAACATGTACTATATGTCAGG + Intronic
1079251165 11:18789198-18789220 CTGAGCATTTTCTATGTGTTAGG + Intronic
1079326162 11:19494417-19494439 ATGAATATGTGCTCTTTGTTAGG + Intronic
1079662958 11:23064669-23064691 GTGAACATTATCTATTTGTATGG + Intergenic
1080067992 11:28042377-28042399 ATAAACCTGTTTTAATTGTTTGG - Intronic
1080184752 11:29468718-29468740 GTTTACATGTTCTCTTTGTTCGG + Intergenic
1080293654 11:30700390-30700412 ATTAACATTTCCTATTTCTTTGG + Intergenic
1080296178 11:30731041-30731063 TTGAACACTTTCTATGTGTTAGG + Intergenic
1084368776 11:68723074-68723096 ATGTATATTCTCTATTTGTTAGG - Intronic
1084682532 11:70674922-70674944 ATGTACATGTATTATTTGTGTGG - Intronic
1084842136 11:71863012-71863034 ATGAACATGAACCATTTGATAGG + Intergenic
1086130564 11:83397350-83397372 ATGTATATTTTTTATTTGTTGGG - Intergenic
1086329270 11:85737534-85737556 TTGAAAATCTTGTATTTGTTAGG - Intronic
1086381538 11:86260034-86260056 ATGGACATGTTATTTCTGTTGGG - Intronic
1087325540 11:96718001-96718023 ATGAACATTTTATGTTAGTTTGG - Intergenic
1088758834 11:112910274-112910296 ATGAACAGGTCAAATTTGTTAGG + Intergenic
1088931323 11:114353456-114353478 ATGAACTTTTTCTATGTGTCAGG + Intergenic
1090527306 11:127551320-127551342 ATGACTAGGTTTTATTTGTTGGG + Intergenic
1091935379 12:4430682-4430704 AAGAAAATGTTCTTTTTGTTAGG + Intronic
1092521638 12:9280994-9281016 ATAAACATATACTATTTGTTAGG - Intergenic
1093377425 12:18447610-18447632 CTGAAAATGTTATGTTTGTTTGG + Intronic
1095754605 12:45750331-45750353 ATGCTAATATTCTATTTGTTTGG - Intronic
1095921481 12:47535794-47535816 ATGACCATGTTGTCTTTTTTTGG - Intergenic
1097530742 12:60796679-60796701 ATGAGCATGCTCTATTTACTTGG - Intergenic
1097883228 12:64704917-64704939 ATGAACATGTTCTGCATGGTGGG + Intergenic
1098688596 12:73457678-73457700 TTGAAAATGTTCTCTGTGTTTGG + Intergenic
1098693629 12:73523007-73523029 ATTGACATTTTCTATTTGATGGG - Intergenic
1099286560 12:80719124-80719146 ATGTACATGTTGTCTTGGTTTGG - Exonic
1099566910 12:84262372-84262394 AGGAAGATGTTCTTTATGTTTGG + Intergenic
1101038460 12:100729402-100729424 TTGAACACGTTCTATGTGGTAGG + Intronic
1105356500 13:19664230-19664252 ATGGAAATGTTCATTTTGTTTGG + Intronic
1105639349 13:22246283-22246305 TTGAACATGTACTAATTGCTAGG - Intergenic
1105971714 13:25434849-25434871 ATGCACGTGTTCTATTGGTATGG + Intronic
1105986065 13:25568443-25568465 ATGAATATTTTCTACTTATTCGG - Intronic
1106278790 13:28243500-28243522 ATGAAAATGTTTTAATTGGTAGG + Intronic
1106573326 13:30950591-30950613 GTGAACATTTTGTAATTGTTAGG + Intronic
1107076426 13:36325844-36325866 ATGAACATGGTCTCATTTTTTGG + Intronic
1107633408 13:42366840-42366862 ATCAACATCTTTTATTGGTTTGG + Intergenic
1108181403 13:47843491-47843513 AGGAATATGTCCTATTAGTTTGG + Intergenic
1108430398 13:50347583-50347605 ATGGACATGTTGAATTTGTGGGG + Intronic
1108666062 13:52632400-52632422 ATTAAAATGTTCTTTTTTTTAGG + Intergenic
1108942829 13:55978385-55978407 ATAAACATCTTCCATTAGTTTGG - Intergenic
1109645377 13:65247113-65247135 CTGAACATGTTTTATTTGCCTGG - Intergenic
1110394227 13:75011358-75011380 ATAAACATGTTTTCTTTTTTAGG + Intergenic
1110605602 13:77428406-77428428 ATGAAAATGTTCAAGTTGGTGGG + Intergenic
1112037548 13:95511027-95511049 ATGAATATGATGTATTTGTCAGG + Intronic
1112545189 13:100361332-100361354 ATGAACATCTTGCATTTGTATGG - Intronic
1113069361 13:106405191-106405213 ATGTTCACATTCTATTTGTTTGG - Intergenic
1113480604 13:110617321-110617343 AAGAACAGGTTAAATTTGTTTGG - Intronic
1114863406 14:26555913-26555935 TTGAACTTTTTCTATTTTTTTGG - Intronic
1115192938 14:30766430-30766452 ATGAATATGATTTATCTGTTAGG - Intergenic
1115915491 14:38308503-38308525 ATCAAAAGGTTCTATATGTTTGG + Intergenic
1116801593 14:49449897-49449919 ATGAAATTGTTCTGTTAGTTTGG - Intergenic
1116920374 14:50565921-50565943 TTGATAATGTTCTATTTCTTTGG - Intronic
1118789632 14:69078234-69078256 ATGGCCATGTTCTACTTCTTTGG - Intronic
1118946440 14:70392194-70392216 ATCAACATTTACTATGTGTTAGG + Intronic
1120783865 14:88512280-88512302 ATGAAGATGTTCATTTTGTTGGG - Intronic
1124546685 15:30634821-30634843 ATAAAGATGTTCAATTTGTGTGG + Intronic
1124780290 15:32624821-32624843 ATAAAGATGTTCAATTTGTGTGG + Intronic
1125076032 15:35619560-35619582 ATGAACTTGTTCTTTTTTTATGG + Intergenic
1125237025 15:37526691-37526713 AAGAACAGGATCTATTTGATAGG + Intergenic
1125468874 15:39982868-39982890 ATGAACTTGTTCTTTTTTTATGG + Intronic
1126572361 15:50165425-50165447 ATGAACATGTTTCTTTTGTGTGG + Intronic
1126886702 15:53158646-53158668 ATGAACATTTTCTAATTGAGTGG + Intergenic
1126926997 15:53600301-53600323 ATAAACATTTTATATTTTTTTGG - Intronic
1127623367 15:60755691-60755713 TTGAACAGCTTCTATGTGTTGGG - Intronic
1129905977 15:79187477-79187499 ACGAGCATGTTACATTTGTTGGG - Intergenic
1130035235 15:80354387-80354409 ATTAACATGTTCTAGGTATTTGG - Intronic
1130242063 15:82203357-82203379 ATGTACATGTTTTGTTTTTTGGG + Intronic
1130809989 15:87366619-87366641 TTGAACTTGTTCTATGTGGTAGG + Intergenic
1135088932 16:19496949-19496971 TTGAACATGTTTTGTTTTTTAGG - Intronic
1137025152 16:35466591-35466613 TTGTACATGTTCTAACTGTTTGG + Intergenic
1137619878 16:49869239-49869261 ATGAAAATGTTACATTTGTTGGG + Intergenic
1139196571 16:64925902-64925924 ATGTACATTTTGTAGTTGTTGGG + Intergenic
1140138703 16:72232826-72232848 CTGAACATGTTCTAAGTGTTAGG + Intergenic
1143952074 17:10641055-10641077 ATAAACATGTTCTATATGCTTGG - Intronic
1144318006 17:14082258-14082280 ATGAACAGGTTCTATTCTTTTGG - Intronic
1145095629 17:20023212-20023234 ATGAACATGGTCTCTTCATTTGG + Intronic
1146966164 17:37032052-37032074 GTGCATATGTTGTATTTGTTGGG + Intronic
1150426822 17:65083753-65083775 ATGAAAATGTTCTATAAATTGGG - Intergenic
1150727708 17:67665060-67665082 ATGTACATGTTTTGTTTTTTGGG + Intronic
1155506146 18:26535179-26535201 CTAAACATTTTCTATTTGTCAGG + Intronic
1155666809 18:28318924-28318946 TTGATCATGTTCTGTTTTTTGGG - Intergenic
1156192807 18:34739246-34739268 ATTATCATTTTCTTTTTGTTTGG + Intronic
1156221151 18:35053515-35053537 ATGAACATGTTACATTTGGGAGG + Intronic
1156612818 18:38747747-38747769 TGTAACATGTTCTATTTGTTTGG - Intergenic
1156991152 18:43409356-43409378 ATGAACATTTTCAACTTTTTAGG + Intergenic
1157244187 18:46039096-46039118 ATGAACAGGTTCTATTTGTAAGG - Intronic
1159048063 18:63389002-63389024 ATGGGCATGTTCTATTTCTCTGG - Intergenic
1159740967 18:72169697-72169719 AAGAATAAGTCCTATTTGTTTGG + Intergenic
1159840450 18:73393154-73393176 ATGAACATGTTGTATTACTCAGG - Intergenic
1160055880 18:75479969-75479991 TTGAAAATGTTGTATTTGTAGGG + Intergenic
1160175055 18:76586838-76586860 ATGCACATGTCCTATGGGTTCGG - Intergenic
1168546764 19:57258815-57258837 ATTAACATTTTCTTTCTGTTTGG + Intergenic
925356169 2:3242969-3242991 ATGTACAAGTTCTTTATGTTGGG + Intronic
926067626 2:9856627-9856649 ATGCATATTTTCTATGTGTTAGG - Intronic
926179719 2:10630978-10631000 AGCAACATATTCTCTTTGTTTGG - Intronic
926830070 2:16952008-16952030 CTGAACCTCTTTTATTTGTTGGG + Intergenic
926855164 2:17248111-17248133 ATGAGCATTTTCTATGTGATAGG - Intergenic
926913001 2:17868864-17868886 AGGAACATGTTCTTTTTTGTAGG - Intergenic
926997503 2:18752588-18752610 ATGAAAATGTTCTACTATTTTGG - Intergenic
928831122 2:35484857-35484879 AAGTACATGTTCTATTTAGTGGG + Intergenic
929300166 2:40294828-40294850 AATAACATGTTTTAATTGTTAGG - Intronic
929309501 2:40406234-40406256 TAGAACATTTTCTTTTTGTTAGG + Intronic
929888006 2:45895599-45895621 ATGATCATGTTTTATTCATTTGG + Intronic
930696662 2:54418453-54418475 CTTAACATGTTCTATCTCTTTGG - Intergenic
930767072 2:55095420-55095442 ATTAACATCTTATATTTGTGAGG + Intronic
931001105 2:57783574-57783596 ATGAGTTTTTTCTATTTGTTTGG + Intergenic
932175720 2:69599207-69599229 ATAGACATGTTCGAATTGTTTGG - Intronic
932618120 2:73248888-73248910 ATCAGCATGTTTTATTTGGTGGG + Intronic
933156833 2:78984923-78984945 ATTTATTTGTTCTATTTGTTTGG - Intergenic
933373467 2:81447331-81447353 ATGAATATGTTCTATATGGAGGG + Intergenic
933535319 2:83565743-83565765 ATCAACATATTATATTTGTGTGG + Intergenic
933582837 2:84146891-84146913 ATCAACATATTCTATCAGTTTGG + Intergenic
936779302 2:116013123-116013145 TTAAACATATTCTATTTGTTTGG - Intergenic
936781926 2:116043626-116043648 ATAAAAATATTCTATTTATTGGG + Intergenic
937586886 2:123563284-123563306 ATTAAAATGTTATTTTTGTTGGG + Intergenic
937808402 2:126172169-126172191 GAGATTATGTTCTATTTGTTTGG - Intergenic
937959186 2:127441653-127441675 ATTAACATGTTGTATTAGTGTGG + Intronic
938207827 2:129438988-129439010 CTGATAATGTTCTGTTTGTTAGG - Intergenic
939143968 2:138390169-138390191 ATTAACAACTTCTATATGTTAGG - Intergenic
939149158 2:138452784-138452806 TTAAACATGTACTATTTCTTAGG - Intergenic
939239758 2:139542662-139542684 TTGAATATCTTCTATTTGCTGGG + Intergenic
939702864 2:145416036-145416058 ATGTACATGTTCATTCTGTTAGG + Intergenic
939965226 2:148604045-148604067 ATGGACATGTTCTCTGTGTGAGG - Intergenic
940479350 2:154208208-154208230 ATTAACTTGTTCTTTTTGTCTGG + Intronic
942061678 2:172233727-172233749 ATGAGCATATTGTATTTCTTAGG - Intergenic
942127127 2:172838205-172838227 ATAAACATGTTTCATTTTTTAGG - Intronic
942717776 2:178913784-178913806 ATGAACATGGTCTGATTTTTGGG - Intronic
943077435 2:183212485-183212507 ATGAATATGTTGAATATGTTAGG - Intergenic
943121825 2:183746006-183746028 AATAACATGTTCTATATTTTAGG - Intergenic
943813869 2:192226186-192226208 ATGATAATGTTTTATTTTTTAGG - Intergenic
945007348 2:205422916-205422938 ATGAGGATGTTTCATTTGTTAGG - Intronic
945073468 2:206014298-206014320 AAGAACTTGTTTTATTTTTTAGG - Intronic
945247809 2:207736046-207736068 ATGAACTGCTTCTATTTGGTGGG + Intronic
945537567 2:211037868-211037890 ATGAACGTGTGCTATCTGTTAGG + Intergenic
946939969 2:224760292-224760314 ATCAACATGATCTTTTTATTTGG - Intergenic
947193091 2:227530539-227530561 ATGAATATCTTCAATTTATTTGG + Intronic
948606643 2:239139919-239139941 ATGGCCATGTTCTTTTTGTTGGG - Intronic
1170359130 20:15525226-15525248 ATTATAATGTTATATTTGTTGGG + Intronic
1170416243 20:16145738-16145760 ATGCAGAACTTCTATTTGTTTGG - Intergenic
1170646409 20:18199760-18199782 ATAAACATTTTAAATTTGTTTGG - Intergenic
1170901986 20:20472942-20472964 ATCAACAGGTTCCATTTTTTGGG - Exonic
1170979979 20:21203268-21203290 ATTTACATGCTCTATTTGGTTGG + Intronic
1172135404 20:32683327-32683349 ATGAACTTGTTCTGTGAGTTAGG - Intergenic
1175316240 20:58048923-58048945 ATTAACATCTTGCATTTGTTTGG + Intergenic
1175481657 20:59315482-59315504 ATGAACATGTTCTATTTGTTGGG + Intronic
1177029532 21:15965657-15965679 ATGAATATATTATATTTGTTAGG - Intergenic
1177685985 21:24438042-24438064 AAGAACACGTTCTTTTTTTTGGG - Intergenic
1177900540 21:26909511-26909533 ATGACCATGTTCTAGTTTTTAGG - Intergenic
1179412108 21:41169612-41169634 ATGAGTATGTTCTATTTATGGGG - Intronic
1180966375 22:19789907-19789929 ATCAACATGGTCTTTTTGTCTGG - Intronic
1181255795 22:21561913-21561935 ACTAACATGTTCTATTTGATAGG - Intronic
1182793265 22:32971084-32971106 TTGAACATTTACTATTTGCTAGG - Intronic
1184920539 22:47602447-47602469 ATAAACATTTTCTCCTTGTTAGG - Intergenic
949851008 3:8420283-8420305 ATAAACATCTTCTATTTTCTTGG + Intergenic
950381366 3:12618251-12618273 ATAAGAATGTACTATTTGTTTGG + Intronic
951856367 3:27201713-27201735 ATGCAAATGTTTTATTTGGTCGG - Intronic
951981035 3:28567480-28567502 ATGAAAATGTAATATTTATTAGG + Intergenic
952399687 3:32951913-32951935 ATGAAAATGATCTATTTATTTGG - Intronic
952443165 3:33354123-33354145 ATTAACATGTTGTATTAGTGTGG - Intronic
952519171 3:34138101-34138123 CTGACCATGTGCTACTTGTTAGG + Intergenic
953187338 3:40651123-40651145 ATGAACATTTTCTATTCCTATGG - Intergenic
953367541 3:42359014-42359036 ATGTAAATGTTATATTTGCTGGG + Intergenic
953651118 3:44805599-44805621 ATAATCATGGACTATTTGTTTGG + Intronic
954730188 3:52653971-52653993 CTCAACATGTTCAATTTCTTGGG - Intronic
955785104 3:62529332-62529354 TTGAACCTGATCTATTTCTTAGG - Intronic
955861748 3:63338062-63338084 ATTAACATCTTCCATTGGTTTGG - Intronic
956310913 3:67879311-67879333 ATGAAGATGTTTTGTTTGTTTGG + Intergenic
957200749 3:77132863-77132885 TTGAACATCTTCTACATGTTAGG + Intronic
957228438 3:77479124-77479146 AGGAACTTTGTCTATTTGTTGGG - Intronic
957885758 3:86285455-86285477 ATGATTATGTACTATTTGTCGGG + Intergenic
958029691 3:88093370-88093392 ATGAACATTTACTTTCTGTTGGG - Intronic
958499780 3:94890236-94890258 ATAAGAATGTTCTATTTCTTCGG - Intergenic
958939801 3:100299140-100299162 ATGAACTTGTTCCCTTTATTTGG + Intronic
960185014 3:114627634-114627656 ATGTACAGGTTTTATTTGCTTGG - Intronic
960743500 3:120860547-120860569 AAGAACTTTTTCTATGTGTTAGG + Intergenic
960828916 3:121823427-121823449 TTTAAGATGTTCTCTTTGTTTGG - Intronic
961096340 3:124159731-124159753 ATGAACACATGCTATTTCTTGGG + Intronic
962015933 3:131440969-131440991 GTCAACATTTTCCATTTGTTGGG + Intergenic
962824750 3:139090107-139090129 ATGTGTATTTTCTATTTGTTGGG + Intronic
963370168 3:144389018-144389040 GTGAACATGTTTTATATGGTGGG - Intergenic
963502122 3:146140776-146140798 AAGAAGAGGTTATATTTGTTTGG - Intronic
963524305 3:146396955-146396977 ATGAATATGTTCTGTTTGTAGGG - Intronic
964530367 3:157661289-157661311 AACAACATGTTCTTTTTGATGGG - Intronic
964538253 3:157750012-157750034 ATTAACATGTTCAATTTTATTGG - Intergenic
964784294 3:160377355-160377377 ATGAAAATATTCTGTTTCTTTGG + Intronic
964857990 3:161167914-161167936 GAGAACATTTTCTATTTTTTTGG + Intronic
965665200 3:171086310-171086332 GTGAAAGTGTTCTATTTGGTAGG - Intronic
966575032 3:181491353-181491375 ATGTGTATCTTCTATTTGTTGGG - Intergenic
966694038 3:182771021-182771043 ATGAACATCTTCTATGTGCTAGG - Intergenic
967430375 3:189377654-189377676 ATAAACATGGACTATTTCTTTGG + Intergenic
967716605 3:192769783-192769805 TAGAACATGTTCTTTTTTTTAGG + Intergenic
968354163 3:198089378-198089400 TTGATCATTTACTATTTGTTAGG + Intergenic
969783244 4:9429055-9429077 ATGAACATGAACCATTTGATAGG + Intergenic
971221030 4:24706134-24706156 ATGAGCATCTGCTATTTGTTTGG + Intergenic
971223370 4:24729482-24729504 ATGCACACACTCTATTTGTTCGG + Intergenic
971431873 4:26576845-26576867 ATGAACCTGTTGTATCTGTTGGG + Intronic
971819605 4:31533994-31534016 ATGAATATGTTCTATATTTTTGG + Intergenic
972202578 4:36733118-36733140 ATGAAGACATTCTATCTGTTAGG + Intergenic
972941977 4:44206950-44206972 ATGAACATTTACTATTTGTTGGG + Intronic
973667272 4:53175143-53175165 TTGAAGTTTTTCTATTTGTTAGG - Intronic
973862664 4:55080443-55080465 ATAAACATGTTCCATCAGTTGGG - Intronic
974449939 4:62041524-62041546 TTGAAAATGTTCTATTTCCTAGG - Intronic
975328933 4:73091702-73091724 ATGAACTGGTTGTAGTTGTTGGG + Exonic
975689976 4:76953226-76953248 AGGAACTTGTTCTAGGTGTTGGG + Intronic
975858655 4:78652269-78652291 AAGAAAATGTTCTAAATGTTAGG + Intergenic
975884359 4:78946596-78946618 CTGAATATGTTCTTTTTGTTAGG + Intergenic
976413057 4:84739388-84739410 ATGAACATTTTGTAATTATTAGG - Intronic
976814404 4:89130479-89130501 TTGAACATGTTCTATCTGCCAGG - Intergenic
978035462 4:103987114-103987136 ATGAAAATCTTCCATTTGTTGGG + Intergenic
978132791 4:105220050-105220072 TTGAACATATTCTATGTGTCAGG - Intronic
979740837 4:124148633-124148655 CTGAGCTTGTTCTAGTTGTTTGG - Intergenic
981036090 4:140170122-140170144 CTGATCATGTCCTATTTATTGGG + Intergenic
982212467 4:153050016-153050038 ATGAAAATATTCTTTTTGGTTGG + Intergenic
983281864 4:165690821-165690843 TTGAACATCTTCAATGTGTTAGG - Intergenic
983875602 4:172871291-172871313 AAGAACATGTTCAACTTGTGGGG - Intronic
983950942 4:173640677-173640699 ATGGTCATCTTTTATTTGTTTGG + Intergenic
984382012 4:179006340-179006362 ATAAAAATGTTCTATTTATTCGG - Intergenic
984463599 4:180069496-180069518 AAGAAAATTTTCTTTTTGTTTGG + Intergenic
984583034 4:181532501-181532523 TTGAACATTTTCCATTTGTATGG - Intergenic
985060626 4:186074177-186074199 ATGACTGTGTTCTATTTCTTTGG - Intronic
986832790 5:11599624-11599646 AAGTACAAGTTCTACTTGTTTGG - Intronic
987010348 5:13756436-13756458 TTGAGCATCTGCTATTTGTTAGG - Intronic
987434459 5:17877169-17877191 ATGAACACGTTTTGTTTGGTAGG - Intergenic
987765513 5:22223824-22223846 CTGACCATGCTCTATTCGTTGGG - Intronic
987978792 5:25052954-25052976 ATGCACATGTTCTAATCCTTTGG - Intergenic
990307441 5:54507025-54507047 ATAAAAATGTTCTCTTAGTTTGG + Intergenic
990821695 5:59847636-59847658 CTGAACATGTTCTTTGTTTTTGG + Intronic
991479440 5:67061298-67061320 ATGTACATGTTTTATTTCTATGG + Intronic
992791649 5:80219491-80219513 ATGAACAGCGGCTATTTGTTTGG - Intronic
993562268 5:89424763-89424785 TTGAACTTGTTTCATTTGTTGGG + Intergenic
993830733 5:92754503-92754525 ATGAACATCTTTTCTTTCTTGGG - Intergenic
994156515 5:96509572-96509594 ATGCTCATGTTATATTTCTTTGG - Intergenic
994499925 5:100562032-100562054 ATTAATTTGTTCTATTTGATAGG + Exonic
995196406 5:109374368-109374390 ATATAGATGTTTTATTTGTTGGG + Intronic
995207490 5:109498001-109498023 ATCTACATGTTCTATTCTTTGGG + Intergenic
995283985 5:110365871-110365893 ATGCAACTTTTCTATTTGTTTGG + Intronic
995415479 5:111907479-111907501 ATCAATTTGCTCTATTTGTTTGG + Intronic
996127467 5:119743164-119743186 ATGTCCATGTTCTAGTTATTTGG + Intergenic
996516821 5:124379359-124379381 ATGAACATTTACTGTGTGTTGGG - Intergenic
996940398 5:128998477-128998499 ATGATCATGATCTATTTATATGG - Intronic
997679662 5:135741038-135741060 CTGAACATTTACTATTTGTCAGG + Intergenic
999276786 5:150336732-150336754 ATTAACATCTTCTATGTGTCAGG + Intronic
1000687213 5:164265897-164265919 ATGAACCTCTTCTGTTTCTTGGG + Intergenic
1003027291 6:2566640-2566662 ATTAACATCTTATATTTGTCTGG + Intergenic
1003645156 6:7908952-7908974 ATTAACAGTTTCTCTTTGTTCGG - Intronic
1003823047 6:9921920-9921942 CTGAACATTTTCTATTTTTCAGG - Intronic
1003830759 6:10008488-10008510 ATTAACATATTCTATTGATTTGG + Intronic
1004234725 6:13864219-13864241 ATGAACATATTCTATACATTGGG - Intergenic
1004572368 6:16859714-16859736 ATCAACATGTTCTATTGGAAGGG + Intergenic
1005121695 6:22397025-22397047 ATTTTCTTGTTCTATTTGTTTGG - Intergenic
1005956538 6:30667616-30667638 CTGAACATGTTATTTTTATTGGG - Intronic
1006714845 6:36110880-36110902 ATCAACATTTTCTAAATGTTAGG - Exonic
1007980449 6:46150474-46150496 ATTCACATTTTTTATTTGTTTGG - Intergenic
1008809921 6:55483944-55483966 ATGAACATTTTGTATTAGTAGGG + Intronic
1009042781 6:58200264-58200286 ATGCACATGTTCAGTTTGTGGGG + Intergenic
1009204354 6:60783906-60783928 ATTAACATGTTGTAGTTATTAGG + Intergenic
1009292363 6:61898999-61899021 ATGAACATTTTATGTTAGTTTGG - Intronic
1009325298 6:62341410-62341432 ATGAATATTCTCTAGTTGTTGGG - Intergenic
1009382649 6:63051965-63051987 ATGAACTTGTTCTTTTTTTATGG + Intergenic
1009714828 6:67377426-67377448 TTAAACATCTTCTGTTTGTTGGG - Intergenic
1011772930 6:90694936-90694958 ATAACCATGTTCTGTGTGTTTGG - Intergenic
1012006841 6:93723148-93723170 ATACACATGTTATATATGTTTGG - Intergenic
1012734725 6:102924764-102924786 ATGACCACGTTTTATTTGTAAGG + Intergenic
1012888213 6:104869226-104869248 ATGAACATCTTCAATTTACTAGG - Intergenic
1013020772 6:106215120-106215142 ATGAACATGTTTTATCCTTTTGG + Intronic
1013806603 6:114003139-114003161 ATTAAAATGTTCTATATTTTCGG + Intronic
1013940329 6:115653201-115653223 ACAAACAGGTCCTATTTGTTTGG - Intergenic
1014598885 6:123383838-123383860 ACGAATATGTTTTATTTGTAAGG + Intronic
1015505508 6:133982388-133982410 ATTAATATGTTCTTTGTGTTTGG + Intronic
1015976018 6:138791605-138791627 ATGAACATGATGTGTTTCTTGGG - Intronic
1016337778 6:143026321-143026343 ATTAAAATGTGCTTTTTGTTAGG - Intergenic
1016861850 6:148728416-148728438 TTGAACATTTTTTATATGTTTGG - Intergenic
1017085898 6:150712425-150712447 ATGAATATGTATTATTTGTGTGG - Intronic
1017337703 6:153281689-153281711 ATGAACATCTACTATATTTTAGG + Intergenic
1018410452 6:163540097-163540119 ATGAATAAGTTCTTTTTTTTTGG + Intronic
1019878659 7:3838984-3839006 ATGAACACCATCTATTTGTAGGG - Intronic
1020802867 7:12753999-12754021 ATGATCATCTTCTATTTTCTAGG + Intergenic
1022279415 7:28891068-28891090 AAGAATATATTCTACTTGTTTGG - Intergenic
1023162912 7:37314775-37314797 ATGATGATGTTTTCTTTGTTCGG - Intronic
1023255288 7:38306687-38306709 AAGAGCATGAACTATTTGTTTGG + Intergenic
1023469301 7:40496883-40496905 ATGAATATGTGTTATTTGTAAGG + Intronic
1026306560 7:69147524-69147546 ATGAACATGTTCCAGCTATTTGG + Intergenic
1026390437 7:69896223-69896245 TTGAACATTTACTATGTGTTAGG + Intronic
1027398008 7:77776357-77776379 ATGAAAATGTTCTATCGTTTTGG - Intronic
1027720322 7:81733320-81733342 ATGAAAAAGTTATATTTATTTGG - Intronic
1027914196 7:84294098-84294120 ATGAACATTTTGTATATTTTTGG + Intronic
1028169284 7:87576555-87576577 TTGAACATTTACTATTTGCTGGG - Intronic
1028946917 7:96590305-96590327 ATAAAAATGAACTATTTGTTAGG - Intronic
1030958052 7:115879704-115879726 ATGTACACGTTCTATTCCTTTGG + Intergenic
1031503062 7:122545625-122545647 TTGAACAAGTTTTGTTTGTTAGG + Intronic
1033353720 7:140582887-140582909 ATGTATATATTCTATTTCTTTGG - Intronic
1034036893 7:147834221-147834243 CTGAACATGTTATATTGTTTGGG + Intronic
1035741906 8:1934979-1935001 TTGAACATCTTCTATTGGGTTGG - Intronic
1035839351 8:2793977-2793999 AGGAACATGTGCTGTCTGTTGGG + Intergenic
1035976650 8:4320074-4320096 TTGAACATGTAATGTTTGTTGGG - Intronic
1036699263 8:11001133-11001155 TTGAACACGTGCTATGTGTTAGG + Intronic
1037675164 8:21044820-21044842 ATAAAGATCTTTTATTTGTTTGG + Intergenic
1038811681 8:30852733-30852755 TTGAAGATGTTGGATTTGTTGGG - Intronic
1038914103 8:32001086-32001108 ATGAACATCTTATATTAGTGTGG + Intronic
1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG + Intronic
1041250252 8:55927039-55927061 ATGAACATGTTACATTAGTGTGG + Intronic
1041640713 8:60197739-60197761 ATGAACATGTGCTATATATGTGG + Intronic
1042153803 8:65819433-65819455 ATTAAAATGTTCAAATTGTTTGG + Intronic
1042709959 8:71706615-71706637 ATGAACATATGCTTGTTGTTTGG + Intergenic
1042725392 8:71869755-71869777 TTGAGCATGTATTATTTGTTGGG + Intronic
1043747601 8:83895566-83895588 CTAAACTTGTTCTATATGTTAGG - Intergenic
1044231999 8:89789299-89789321 ATGAAGATGTTGTATTTTGTAGG + Exonic
1044437558 8:92183344-92183366 ATAAACATTTTCTATGTTTTTGG + Intergenic
1044498258 8:92917708-92917730 ATTTACATGTTCTTTGTGTTGGG + Intronic
1044519173 8:93177896-93177918 AAGAACATTTTCTAATTCTTTGG + Intergenic
1044571473 8:93723616-93723638 ATTAACATCTTCTATTTGCCAGG + Intronic
1045133390 8:99184181-99184203 ATGAACATGTAGTCTTTGTGTGG + Intronic
1046083296 8:109399161-109399183 ATGAACCTCTTAAATTTGTTTGG + Intronic
1046542004 8:115597526-115597548 ATGTACATTCTCTAATTGTTTGG + Intronic
1047557915 8:125952737-125952759 ATGAAAATGTTTTCTTTGTAAGG + Intergenic
1050317040 9:4413069-4413091 TTGAGCATGTTGTATTTGTTAGG - Intergenic
1052087479 9:24285907-24285929 ATGAACATTTTATATTAGTATGG + Intergenic
1053540850 9:38972252-38972274 ATGAACATGGTATGTTTGTGTGG - Intergenic
1053612662 9:39731228-39731250 ACGCACATGTTCTATTTCCTGGG + Intergenic
1053805267 9:41795304-41795326 ATGAACATGGTATGTTTGTGTGG - Intergenic
1053870704 9:42489189-42489211 ACGCACATGTTCTATTTCCTGGG + Intergenic
1054085590 9:60739927-60739949 ACGCACATGTTCTATTTCCTGGG - Intergenic
1054240853 9:62611162-62611184 ACGCACATGTTCTATTTCCTGGG - Intergenic
1054554985 9:66645686-66645708 ACGCACATGTTCTATTTCCTGGG - Intergenic
1054625289 9:67391654-67391676 ATGAACATGGTATGTTTGTGTGG + Intergenic
1054958952 9:70945750-70945772 ATTAACTTGTTCTATATTTTAGG - Intronic
1055071955 9:72175426-72175448 CTGAACATGTTCTCTTTCCTGGG - Intronic
1055221365 9:73936107-73936129 ATTAAAATGTTATATCTGTTAGG - Intergenic
1055256781 9:74381202-74381224 CTTAACATGTTCTATTTGATGGG + Intergenic
1056080135 9:83084490-83084512 CTCAAAATGTCCTATTTGTTAGG + Intergenic
1056953479 9:91064391-91064413 ATGAAAATGTTCAGTATGTTTGG - Intergenic
1057614505 9:96576919-96576941 TTGAACATGGTCTATGTGTATGG - Intronic
1058186266 9:101859373-101859395 AGTAACATGTTTTATTTGTCTGG - Intergenic
1059982309 9:119786432-119786454 ATAAACATGATTGATTTGTTAGG - Intergenic
1060628410 9:125134549-125134571 AGGAACAAGATCCATTTGTTTGG - Intronic
1061737608 9:132671903-132671925 ATAAACATGTTCTCTATGTGCGG - Intronic
1061890685 9:133617597-133617619 CAGGACATGTGCTATTTGTTTGG - Intergenic
1186020952 X:5254596-5254618 ATGAAGAGCTTCAATTTGTTTGG + Intergenic
1186698556 X:12064808-12064830 ATGAACATTTTCAATTGTTTTGG - Intergenic
1188503027 X:30849938-30849960 AAGAACACTTACTATTTGTTGGG + Intronic
1188905817 X:35789847-35789869 ATACACATGTTCTATTTGAATGG + Intergenic
1188976734 X:36684480-36684502 ATTAACAAGTTCCATTTATTAGG - Intergenic
1191965396 X:66751754-66751776 ATGAACATTTTCTAAGTCTTGGG - Intergenic
1193225734 X:78981322-78981344 TTGAACATTTACTATTTGCTGGG + Intergenic
1193312658 X:80025869-80025891 ATGCACATGTTGTGTTTTTTAGG + Intronic
1193398218 X:81010842-81010864 GTAAACATGTTTTATTTCTTTGG + Intergenic
1193398703 X:81016373-81016395 ATGAAATTGTGTTATTTGTTTGG + Intergenic
1193918373 X:87395947-87395969 ATGAAGATGTTCCATTAGCTGGG + Intergenic
1195521198 X:105831717-105831739 ATGTATATGTTATATGTGTTGGG + Intronic
1196713810 X:118792199-118792221 ATGAACAAATTTTATTTGTAGGG + Exonic
1197313379 X:124933365-124933387 ATGGACATATTCTATTTGACTGG - Intronic
1197346659 X:125332268-125332290 ATCCAGATGTTCTGTTTGTTTGG - Intergenic
1197361521 X:125510269-125510291 ATCTAAATGTTCTATTTTTTTGG - Intergenic
1197918899 X:131567787-131567809 TTGAATATATTCTATGTGTTAGG + Intergenic
1198576294 X:138013592-138013614 AGGAACATGTTCTATTGGCTAGG + Intergenic
1199040242 X:143106404-143106426 ATAAACATGTTTCATTTCTTTGG - Intergenic
1199399476 X:147380446-147380468 ATGAAAATGTTACATTTGTTGGG - Intergenic
1199496510 X:148458421-148458443 ATGGACAAGTGCTATCTGTTAGG + Intergenic
1199817114 X:151408190-151408212 ATGAAAATGTTCCAATTATTAGG - Exonic
1199907558 X:152249408-152249430 TTGAACACCTACTATTTGTTAGG - Intronic