ID: 1175486466

View in Genome Browser
Species Human (GRCh38)
Location 20:59350310-59350332
Sequence TAGGGAGATCAGAGGCATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175486458_1175486466 10 Left 1175486458 20:59350277-59350299 CCGGGTGGTGGCGGGTGGGGAGG No data
Right 1175486466 20:59350310-59350332 TAGGGAGATCAGAGGCATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175486466 Original CRISPR TAGGGAGATCAGAGGCATGC GGG Intergenic
No off target data available for this crispr