ID: 1175487580

View in Genome Browser
Species Human (GRCh38)
Location 20:59356484-59356506
Sequence CCTTCTGAAGGATCTGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175487580_1175487588 10 Left 1175487580 20:59356484-59356506 CCTCCAGCAGATCCTTCAGAAGG No data
Right 1175487588 20:59356517-59356539 GCTGTCACTGGGCCTTCCCAAGG No data
1175487580_1175487589 20 Left 1175487580 20:59356484-59356506 CCTCCAGCAGATCCTTCAGAAGG No data
Right 1175487589 20:59356527-59356549 GGCCTTCCCAAGGCAAGCCCAGG No data
1175487580_1175487586 -2 Left 1175487580 20:59356484-59356506 CCTCCAGCAGATCCTTCAGAAGG No data
Right 1175487586 20:59356505-59356527 GGAAGGAAGGAAGCTGTCACTGG No data
1175487580_1175487587 -1 Left 1175487580 20:59356484-59356506 CCTCCAGCAGATCCTTCAGAAGG No data
Right 1175487587 20:59356506-59356528 GAAGGAAGGAAGCTGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175487580 Original CRISPR CCTTCTGAAGGATCTGCTGG AGG (reversed) Intergenic
No off target data available for this crispr