ID: 1175488143

View in Genome Browser
Species Human (GRCh38)
Location 20:59360206-59360228
Sequence TGGGGTTGTAAATCTCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175488142_1175488143 -6 Left 1175488142 20:59360189-59360211 CCAGTGGAGGCAATGCTTGGGGT No data
Right 1175488143 20:59360206-59360228 TGGGGTTGTAAATCTCTTGCTGG No data
1175488140_1175488143 -5 Left 1175488140 20:59360188-59360210 CCCAGTGGAGGCAATGCTTGGGG No data
Right 1175488143 20:59360206-59360228 TGGGGTTGTAAATCTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175488143 Original CRISPR TGGGGTTGTAAATCTCTTGC TGG Intergenic
No off target data available for this crispr