ID: 1175489010

View in Genome Browser
Species Human (GRCh38)
Location 20:59366009-59366031
Sequence CAGCCGTAATGGCACTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175489005_1175489010 8 Left 1175489005 20:59365978-59366000 CCCGAAAGGTTTTAGCAAAATTC No data
Right 1175489010 20:59366009-59366031 CAGCCGTAATGGCACTATTAAGG No data
1175489006_1175489010 7 Left 1175489006 20:59365979-59366001 CCGAAAGGTTTTAGCAAAATTCA No data
Right 1175489010 20:59366009-59366031 CAGCCGTAATGGCACTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175489010 Original CRISPR CAGCCGTAATGGCACTATTA AGG Intergenic
No off target data available for this crispr