ID: 1175495761

View in Genome Browser
Species Human (GRCh38)
Location 20:59413155-59413177
Sequence TCTCAAACGGCCACCTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175495761_1175495767 20 Left 1175495761 20:59413155-59413177 CCTTTGGAGGTGGCCGTTTGAGA No data
Right 1175495767 20:59413198-59413220 CCCTCCTCCCACCCTCCCTGAGG No data
1175495761_1175495770 26 Left 1175495761 20:59413155-59413177 CCTTTGGAGGTGGCCGTTTGAGA No data
Right 1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG No data
1175495761_1175495773 29 Left 1175495761 20:59413155-59413177 CCTTTGGAGGTGGCCGTTTGAGA No data
Right 1175495773 20:59413207-59413229 CACCCTCCCTGAGGCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175495761 Original CRISPR TCTCAAACGGCCACCTCCAA AGG (reversed) Intergenic
No off target data available for this crispr