ID: 1175495764

View in Genome Browser
Species Human (GRCh38)
Location 20:59413186-59413208
Sequence TGGGAGGAGGGAGGTGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175495764_1175495770 -5 Left 1175495764 20:59413186-59413208 CCACGCTCACCTCCCTCCTCCCA No data
Right 1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG No data
1175495764_1175495773 -2 Left 1175495764 20:59413186-59413208 CCACGCTCACCTCCCTCCTCCCA No data
Right 1175495773 20:59413207-59413229 CACCCTCCCTGAGGCCCTGGAGG No data
1175495764_1175495781 22 Left 1175495764 20:59413186-59413208 CCACGCTCACCTCCCTCCTCCCA No data
Right 1175495781 20:59413231-59413253 ACGACTCACTCTAGCAAAGGAGG No data
1175495764_1175495780 19 Left 1175495764 20:59413186-59413208 CCACGCTCACCTCCCTCCTCCCA No data
Right 1175495780 20:59413228-59413250 GGCACGACTCACTCTAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175495764 Original CRISPR TGGGAGGAGGGAGGTGAGCG TGG (reversed) Intergenic
No off target data available for this crispr