ID: 1175495770

View in Genome Browser
Species Human (GRCh38)
Location 20:59413204-59413226
Sequence TCCCACCCTCCCTGAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175495762_1175495770 13 Left 1175495762 20:59413168-59413190 CCGTTTGAGAGAAGCCAGCCACG No data
Right 1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG No data
1175495764_1175495770 -5 Left 1175495764 20:59413186-59413208 CCACGCTCACCTCCCTCCTCCCA No data
Right 1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG No data
1175495761_1175495770 26 Left 1175495761 20:59413155-59413177 CCTTTGGAGGTGGCCGTTTGAGA No data
Right 1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG No data
1175495763_1175495770 -1 Left 1175495763 20:59413182-59413204 CCAGCCACGCTCACCTCCCTCCT No data
Right 1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175495770 Original CRISPR TCCCACCCTCCCTGAGGCCC TGG Intergenic
No off target data available for this crispr