ID: 1175496034

View in Genome Browser
Species Human (GRCh38)
Location 20:59414964-59414986
Sequence GTAGCTTTCTAGCGATCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175496034_1175496035 11 Left 1175496034 20:59414964-59414986 CCATTGGATCGCTAGAAAGCTAC No data
Right 1175496035 20:59414998-59415020 TAAGCTGAACATTCAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175496034 Original CRISPR GTAGCTTTCTAGCGATCCAA TGG (reversed) Intergenic
No off target data available for this crispr