ID: 1175497031

View in Genome Browser
Species Human (GRCh38)
Location 20:59422410-59422432
Sequence CCCCAACCTGGGCCAGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175497018_1175497031 29 Left 1175497018 20:59422358-59422380 CCAATGCAAGGCAGGTGCTGGGT No data
Right 1175497031 20:59422410-59422432 CCCCAACCTGGGCCAGCCTTTGG No data
1175497026_1175497031 2 Left 1175497026 20:59422385-59422407 CCAGGTGACTTGGGAAGAGTGGG No data
Right 1175497031 20:59422410-59422432 CCCCAACCTGGGCCAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175497031 Original CRISPR CCCCAACCTGGGCCAGCCTT TGG Intergenic
No off target data available for this crispr