ID: 1175497226

View in Genome Browser
Species Human (GRCh38)
Location 20:59423481-59423503
Sequence CATCCTAGGTTGAGTGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175497226_1175497228 -3 Left 1175497226 20:59423481-59423503 CCTGTAGCACTCAACCTAGGATG No data
Right 1175497228 20:59423501-59423523 ATGCCTCCTGAGACCAGAGATGG No data
1175497226_1175497236 24 Left 1175497226 20:59423481-59423503 CCTGTAGCACTCAACCTAGGATG No data
Right 1175497236 20:59423528-59423550 AGTCCTTCTCTACTGGGGAGAGG No data
1175497226_1175497232 17 Left 1175497226 20:59423481-59423503 CCTGTAGCACTCAACCTAGGATG No data
Right 1175497232 20:59423521-59423543 TGGTTCCAGTCCTTCTCTACTGG No data
1175497226_1175497233 18 Left 1175497226 20:59423481-59423503 CCTGTAGCACTCAACCTAGGATG No data
Right 1175497233 20:59423522-59423544 GGTTCCAGTCCTTCTCTACTGGG No data
1175497226_1175497234 19 Left 1175497226 20:59423481-59423503 CCTGTAGCACTCAACCTAGGATG No data
Right 1175497234 20:59423523-59423545 GTTCCAGTCCTTCTCTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175497226 Original CRISPR CATCCTAGGTTGAGTGCTAC AGG (reversed) Intergenic
No off target data available for this crispr