ID: 1175499790

View in Genome Browser
Species Human (GRCh38)
Location 20:59441691-59441713
Sequence TGAGCTCTGCTTGTACAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175499790_1175499796 1 Left 1175499790 20:59441691-59441713 CCACCTTGTACAAGCAGAGCTCA No data
Right 1175499796 20:59441715-59441737 ACCAGCATAACTCGGGGAGGAGG No data
1175499790_1175499799 6 Left 1175499790 20:59441691-59441713 CCACCTTGTACAAGCAGAGCTCA No data
Right 1175499799 20:59441720-59441742 CATAACTCGGGGAGGAGGCAGGG No data
1175499790_1175499794 -5 Left 1175499790 20:59441691-59441713 CCACCTTGTACAAGCAGAGCTCA No data
Right 1175499794 20:59441709-59441731 GCTCACACCAGCATAACTCGGGG No data
1175499790_1175499793 -6 Left 1175499790 20:59441691-59441713 CCACCTTGTACAAGCAGAGCTCA No data
Right 1175499793 20:59441708-59441730 AGCTCACACCAGCATAACTCGGG No data
1175499790_1175499798 5 Left 1175499790 20:59441691-59441713 CCACCTTGTACAAGCAGAGCTCA No data
Right 1175499798 20:59441719-59441741 GCATAACTCGGGGAGGAGGCAGG No data
1175499790_1175499792 -7 Left 1175499790 20:59441691-59441713 CCACCTTGTACAAGCAGAGCTCA No data
Right 1175499792 20:59441707-59441729 GAGCTCACACCAGCATAACTCGG No data
1175499790_1175499795 -2 Left 1175499790 20:59441691-59441713 CCACCTTGTACAAGCAGAGCTCA No data
Right 1175499795 20:59441712-59441734 CACACCAGCATAACTCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175499790 Original CRISPR TGAGCTCTGCTTGTACAAGG TGG (reversed) Intergenic
No off target data available for this crispr