ID: 1175503978

View in Genome Browser
Species Human (GRCh38)
Location 20:59469152-59469174
Sequence GCCTCTCCCCGACTGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175503978_1175503984 16 Left 1175503978 20:59469152-59469174 CCTGGAGGCAGTCGGGGAGAGGC No data
Right 1175503984 20:59469191-59469213 AGGTAAAATACAGAGTATCCAGG No data
1175503978_1175503982 -4 Left 1175503978 20:59469152-59469174 CCTGGAGGCAGTCGGGGAGAGGC No data
Right 1175503982 20:59469171-59469193 AGGCCTTGACTGGGGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175503978 Original CRISPR GCCTCTCCCCGACTGCCTCC AGG (reversed) Intergenic
No off target data available for this crispr