ID: 1175504002

View in Genome Browser
Species Human (GRCh38)
Location 20:59469368-59469390
Sequence CACCTTCAGCTGCTGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175504002_1175504006 14 Left 1175504002 20:59469368-59469390 CCCAGCACCAGCAGCTGAAGGTG No data
Right 1175504006 20:59469405-59469427 TGATCAAGCGTTAGGAGCCGTGG No data
1175504002_1175504009 26 Left 1175504002 20:59469368-59469390 CCCAGCACCAGCAGCTGAAGGTG No data
Right 1175504009 20:59469417-59469439 AGGAGCCGTGGTGTGTGGCAGGG No data
1175504002_1175504010 30 Left 1175504002 20:59469368-59469390 CCCAGCACCAGCAGCTGAAGGTG No data
Right 1175504010 20:59469421-59469443 GCCGTGGTGTGTGGCAGGGCAGG No data
1175504002_1175504008 25 Left 1175504002 20:59469368-59469390 CCCAGCACCAGCAGCTGAAGGTG No data
Right 1175504008 20:59469416-59469438 TAGGAGCCGTGGTGTGTGGCAGG No data
1175504002_1175504005 6 Left 1175504002 20:59469368-59469390 CCCAGCACCAGCAGCTGAAGGTG No data
Right 1175504005 20:59469397-59469419 CATTCATTTGATCAAGCGTTAGG No data
1175504002_1175504007 21 Left 1175504002 20:59469368-59469390 CCCAGCACCAGCAGCTGAAGGTG No data
Right 1175504007 20:59469412-59469434 GCGTTAGGAGCCGTGGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175504002 Original CRISPR CACCTTCAGCTGCTGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr