ID: 1175504788

View in Genome Browser
Species Human (GRCh38)
Location 20:59473953-59473975
Sequence CTGAATATACAAATGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175504788_1175504790 -7 Left 1175504788 20:59473953-59473975 CCATGGTCCATTTGTATATTCAG No data
Right 1175504790 20:59473969-59473991 TATTCAGTATCTCAGTGAGATGG No data
1175504788_1175504791 2 Left 1175504788 20:59473953-59473975 CCATGGTCCATTTGTATATTCAG No data
Right 1175504791 20:59473978-59474000 TCTCAGTGAGATGGAGCAAGAGG No data
1175504788_1175504792 3 Left 1175504788 20:59473953-59473975 CCATGGTCCATTTGTATATTCAG No data
Right 1175504792 20:59473979-59474001 CTCAGTGAGATGGAGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175504788 Original CRISPR CTGAATATACAAATGGACCA TGG (reversed) Intergenic
No off target data available for this crispr