ID: 1175506682

View in Genome Browser
Species Human (GRCh38)
Location 20:59490939-59490961
Sequence ACTGAGGTGGAGAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175506677_1175506682 -7 Left 1175506677 20:59490923-59490945 CCTGTGCCTCTGGGACACTGAGG No data
Right 1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG No data
1175506676_1175506682 -6 Left 1175506676 20:59490922-59490944 CCCTGTGCCTCTGGGACACTGAG No data
Right 1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG No data
1175506672_1175506682 15 Left 1175506672 20:59490901-59490923 CCCGCAGGAGCTCGGCTTTTTCC No data
Right 1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG No data
1175506669_1175506682 24 Left 1175506669 20:59490892-59490914 CCCAGACTTCCCGCAGGAGCTCG No data
Right 1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG No data
1175506670_1175506682 23 Left 1175506670 20:59490893-59490915 CCAGACTTCCCGCAGGAGCTCGG No data
Right 1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG No data
1175506673_1175506682 14 Left 1175506673 20:59490902-59490924 CCGCAGGAGCTCGGCTTTTTCCC No data
Right 1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175506682 Original CRISPR ACTGAGGTGGAGAATGTGGA TGG Intergenic
No off target data available for this crispr