ID: 1175515323

View in Genome Browser
Species Human (GRCh38)
Location 20:59566321-59566343
Sequence CCGATGGCAGCCCACAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175515323_1175515329 13 Left 1175515323 20:59566321-59566343 CCTGGCTTGTGGGCTGCCATCGG No data
Right 1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG No data
1175515323_1175515335 28 Left 1175515323 20:59566321-59566343 CCTGGCTTGTGGGCTGCCATCGG No data
Right 1175515335 20:59566372-59566394 CCCTGAGGGACACAGCTGCTTGG No data
1175515323_1175515326 -8 Left 1175515323 20:59566321-59566343 CCTGGCTTGTGGGCTGCCATCGG No data
Right 1175515326 20:59566336-59566358 GCCATCGGTCACGCTGGCCATGG No data
1175515323_1175515337 29 Left 1175515323 20:59566321-59566343 CCTGGCTTGTGGGCTGCCATCGG No data
Right 1175515337 20:59566373-59566395 CCTGAGGGACACAGCTGCTTGGG No data
1175515323_1175515330 14 Left 1175515323 20:59566321-59566343 CCTGGCTTGTGGGCTGCCATCGG No data
Right 1175515330 20:59566358-59566380 GCCATGTTGACCACCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175515323 Original CRISPR CCGATGGCAGCCCACAAGCC AGG (reversed) Intergenic