ID: 1175515327

View in Genome Browser
Species Human (GRCh38)
Location 20:59566337-59566359
Sequence GCCATGGCCAGCGTGACCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175515327_1175515337 13 Left 1175515327 20:59566337-59566359 CCATCGGTCACGCTGGCCATGGC No data
Right 1175515337 20:59566373-59566395 CCTGAGGGACACAGCTGCTTGGG No data
1175515327_1175515338 16 Left 1175515327 20:59566337-59566359 CCATCGGTCACGCTGGCCATGGC No data
Right 1175515338 20:59566376-59566398 GAGGGACACAGCTGCTTGGGAGG No data
1175515327_1175515339 17 Left 1175515327 20:59566337-59566359 CCATCGGTCACGCTGGCCATGGC No data
Right 1175515339 20:59566377-59566399 AGGGACACAGCTGCTTGGGAGGG No data
1175515327_1175515329 -3 Left 1175515327 20:59566337-59566359 CCATCGGTCACGCTGGCCATGGC No data
Right 1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG No data
1175515327_1175515335 12 Left 1175515327 20:59566337-59566359 CCATCGGTCACGCTGGCCATGGC No data
Right 1175515335 20:59566372-59566394 CCCTGAGGGACACAGCTGCTTGG No data
1175515327_1175515340 18 Left 1175515327 20:59566337-59566359 CCATCGGTCACGCTGGCCATGGC No data
Right 1175515340 20:59566378-59566400 GGGACACAGCTGCTTGGGAGGGG No data
1175515327_1175515330 -2 Left 1175515327 20:59566337-59566359 CCATCGGTCACGCTGGCCATGGC No data
Right 1175515330 20:59566358-59566380 GCCATGTTGACCACCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175515327 Original CRISPR GCCATGGCCAGCGTGACCGA TGG (reversed) Intergenic