ID: 1175515329

View in Genome Browser
Species Human (GRCh38)
Location 20:59566357-59566379
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175515319_1175515329 29 Left 1175515319 20:59566305-59566327 CCAAGCATAGGCAGGCCCTGGCT No data
Right 1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG No data
1175515322_1175515329 14 Left 1175515322 20:59566320-59566342 CCCTGGCTTGTGGGCTGCCATCG No data
Right 1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG No data
1175515323_1175515329 13 Left 1175515323 20:59566321-59566343 CCTGGCTTGTGGGCTGCCATCGG No data
Right 1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG No data
1175515327_1175515329 -3 Left 1175515327 20:59566337-59566359 CCATCGGTCACGCTGGCCATGGC No data
Right 1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175515329 Original CRISPR GGCCATGTTGACCACCCCTG AGG Intergenic