ID: 1175516049

View in Genome Browser
Species Human (GRCh38)
Location 20:59570902-59570924
Sequence GGGTTGATTACAGAACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175516049_1175516060 1 Left 1175516049 20:59570902-59570924 CCTGGGTGTTCTGTAATCAACCC No data
Right 1175516060 20:59570926-59570948 CCATGGGTACTGAGGGACTAGGG No data
1175516049_1175516053 -6 Left 1175516049 20:59570902-59570924 CCTGGGTGTTCTGTAATCAACCC No data
Right 1175516053 20:59570919-59570941 CAACCCCCCATGGGTACTGAGGG No data
1175516049_1175516058 0 Left 1175516049 20:59570902-59570924 CCTGGGTGTTCTGTAATCAACCC No data
Right 1175516058 20:59570925-59570947 CCCATGGGTACTGAGGGACTAGG No data
1175516049_1175516052 -7 Left 1175516049 20:59570902-59570924 CCTGGGTGTTCTGTAATCAACCC No data
Right 1175516052 20:59570918-59570940 TCAACCCCCCATGGGTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175516049 Original CRISPR GGGTTGATTACAGAACACCC AGG (reversed) Intergenic
No off target data available for this crispr