ID: 1175516169

View in Genome Browser
Species Human (GRCh38)
Location 20:59571692-59571714
Sequence CTCGCCTGCACCCGTCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175516162_1175516169 9 Left 1175516162 20:59571660-59571682 CCACCCACCAGAATTGGGGAGAG No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data
1175516154_1175516169 28 Left 1175516154 20:59571641-59571663 CCCCTAGCAGGGGCACCTCCCAC No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data
1175516167_1175516169 2 Left 1175516167 20:59571667-59571689 CCAGAATTGGGGAGAGTTGGGCA No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data
1175516163_1175516169 6 Left 1175516163 20:59571663-59571685 CCCACCAGAATTGGGGAGAGTTG No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data
1175516156_1175516169 26 Left 1175516156 20:59571643-59571665 CCTAGCAGGGGCACCTCCCACCC No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data
1175516159_1175516169 13 Left 1175516159 20:59571656-59571678 CCTCCCACCCACCAGAATTGGGG No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data
1175516161_1175516169 10 Left 1175516161 20:59571659-59571681 CCCACCCACCAGAATTGGGGAGA No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data
1175516164_1175516169 5 Left 1175516164 20:59571664-59571686 CCACCAGAATTGGGGAGAGTTGG No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data
1175516155_1175516169 27 Left 1175516155 20:59571642-59571664 CCCTAGCAGGGGCACCTCCCACC No data
Right 1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175516169 Original CRISPR CTCGCCTGCACCCGTCCTAG TGG Intergenic
No off target data available for this crispr