ID: 1175522378

View in Genome Browser
Species Human (GRCh38)
Location 20:59610177-59610199
Sequence CTGGGGAAGCAGAGGTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2752
Summary {0: 2, 1: 9, 2: 71, 3: 651, 4: 2019}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175522369_1175522378 16 Left 1175522369 20:59610138-59610160 CCAGCTACTTGGGGGGCTGAGCC 0: 8
1: 1403
2: 91846
3: 205227
4: 243228
Right 1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG 0: 2
1: 9
2: 71
3: 651
4: 2019
1175522368_1175522378 17 Left 1175522368 20:59610137-59610159 CCCAGCTACTTGGGGGGCTGAGC 0: 9
1: 2116
2: 106558
3: 217718
4: 254785
Right 1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG 0: 2
1: 9
2: 71
3: 651
4: 2019
1175522364_1175522378 25 Left 1175522364 20:59610129-59610151 CCTGTCGTCCCAGCTACTTGGGG 0: 8
1: 1369
2: 51521
3: 169382
4: 232822
Right 1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG 0: 2
1: 9
2: 71
3: 651
4: 2019
1175522374_1175522378 -5 Left 1175522374 20:59610159-59610181 CCGGGAGGATCGCTTGAGCTGGG 0: 1
1: 1
2: 15
3: 168
4: 957
Right 1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG 0: 2
1: 9
2: 71
3: 651
4: 2019

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175522378 Original CRISPR CTGGGGAAGCAGAGGTTGCA TGG Intronic
Too many off-targets to display for this crispr