ID: 1175524229

View in Genome Browser
Species Human (GRCh38)
Location 20:59622578-59622600
Sequence CACCCCTCGCAGCAGGCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175524229_1175524236 14 Left 1175524229 20:59622578-59622600 CCGTGTGCCTGCTGCGAGGGGTG 0: 1
1: 0
2: 0
3: 27
4: 261
Right 1175524236 20:59622615-59622637 GGGAGGCCCAGAGACTGCCCCGG 0: 1
1: 0
2: 1
3: 41
4: 389
1175524229_1175524233 -3 Left 1175524229 20:59622578-59622600 CCGTGTGCCTGCTGCGAGGGGTG 0: 1
1: 0
2: 0
3: 27
4: 261
Right 1175524233 20:59622598-59622620 GTGCTCCCTGTTTGCTAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
1175524229_1175524232 -6 Left 1175524229 20:59622578-59622600 CCGTGTGCCTGCTGCGAGGGGTG 0: 1
1: 0
2: 0
3: 27
4: 261
Right 1175524232 20:59622595-59622617 GGGGTGCTCCCTGTTTGCTAGGG 0: 1
1: 0
2: 1
3: 7
4: 127
1175524229_1175524231 -7 Left 1175524229 20:59622578-59622600 CCGTGTGCCTGCTGCGAGGGGTG 0: 1
1: 0
2: 0
3: 27
4: 261
Right 1175524231 20:59622594-59622616 AGGGGTGCTCCCTGTTTGCTAGG 0: 1
1: 0
2: 0
3: 13
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175524229 Original CRISPR CACCCCTCGCAGCAGGCACA CGG (reversed) Intronic
900402531 1:2478413-2478435 CACTCCTCGCAGGAGAGACACGG - Intronic
901034913 1:6330684-6330706 ATCCCCTCGCTGCAGGGACAGGG - Intronic
901084566 1:6602743-6602765 CAGGCCGCGCAGCAGGCTCAGGG + Exonic
901156891 1:7146219-7146241 CACCCCTCGCAGCAGGAGCTTGG + Intronic
901511212 1:9718922-9718944 CACCCCTCCCAGCCGGCCCTGGG - Intronic
904314199 1:29649839-29649861 CACCAATCGCAGCAGCCACTTGG - Intergenic
904885949 1:33738590-33738612 CACAGCTTGCAGCAGGCACACGG - Intronic
906150575 1:43585199-43585221 CACCCACTGCTGCAGGCACAGGG - Intronic
908522183 1:64955164-64955186 CACCTTTCCCAGTAGGCACACGG - Intronic
910873410 1:91855348-91855370 CACCCCTCTCACCTGGCACAAGG + Intronic
912409535 1:109470647-109470669 CACCCCTGTCACCAAGCACAAGG - Intronic
913050652 1:115114226-115114248 CACCCTTAGCAGCAGTCTCACGG + Intergenic
913256688 1:116960517-116960539 CACCCTTCTCTGCAGGGACATGG + Intronic
915937422 1:160097705-160097727 CACCCACCACAGCAGGCACAAGG + Intronic
918388576 1:184036313-184036335 CCCTCCCCGCAGCAGACACAGGG + Intronic
920876681 1:209842702-209842724 CACTCCTCCCAGCAGGCCCCTGG + Intronic
921042467 1:211447411-211447433 CACCCCTGGCAGCAGTGGCATGG + Intergenic
922166184 1:223117322-223117344 CACACCTCCCAGCAAGCAGAGGG + Intronic
922892298 1:229071450-229071472 CACCGCTCTCAGCAGGGACCAGG - Intergenic
924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG + Intergenic
924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG + Intergenic
1062968573 10:1628947-1628969 CAGCCCTCGCAGGAGCTACAGGG - Intronic
1063434921 10:6021887-6021909 CACCCCTTGCAGGAGTGACAGGG - Intronic
1066060523 10:31719613-31719635 CACCCCACCCAGGAAGCACAAGG - Intergenic
1066520501 10:36213051-36213073 CACCCCTCGTCCCATGCACAGGG + Intergenic
1066527508 10:36297149-36297171 CATCCCCCACAGCAGCCACATGG - Intergenic
1067290408 10:44935547-44935569 CACCCATCTCTGCAGGCCCAGGG + Exonic
1067378861 10:45753964-45753986 CAGCCCGCACAGCAGGCACAAGG - Intronic
1067882680 10:50060222-50060244 CAGCCCGCACAGCACGCACAAGG + Intergenic
1067886564 10:50094626-50094648 CAGCCCGCACAGCAGGCACAAGG - Intronic
1068178235 10:53489468-53489490 CACTCATAGCAGCAGGCAAAAGG + Intergenic
1068434437 10:56972844-56972866 CAACCCTGGCAGAAGGCAAAGGG + Intergenic
1068698970 10:60000051-60000073 CACCATTCACAGCAGGAACAGGG - Intergenic
1074800127 10:116991441-116991463 CACCCCTGGCAGAAGGCGAAGGG + Intronic
1075068698 10:119306693-119306715 CACCCCACCCACCAGGCTCAGGG - Intronic
1076444891 10:130507567-130507589 CACCCCACCCAGCAGGAAAAAGG - Intergenic
1076813203 10:132899658-132899680 GACTCCTCGCTGCAGGAACAGGG + Exonic
1077077505 11:708183-708205 CAGCCCTGGCAGGAGGCAGATGG + Intronic
1077102103 11:827015-827037 GACCCCCCGGAGCAGGGACAAGG - Intronic
1077228254 11:1447613-1447635 CACCCTGCCCAGCAGTCACACGG + Intronic
1077500112 11:2905667-2905689 CAGCCCTCGGAGCAGGCCCCAGG - Intronic
1078413373 11:11146058-11146080 CACATCTCGCACCTGGCACATGG + Intergenic
1079078399 11:17397450-17397472 CAGCCCTCCCTGGAGGCACAGGG + Intronic
1079099494 11:17532080-17532102 CACTCTTCTCAGCAGGCTCAAGG + Intronic
1082924592 11:58531923-58531945 CACACCTCCCCGCAGGCAGAGGG - Intronic
1084412338 11:69012202-69012224 CTCCCCTCGGAGCAAGCCCAAGG + Intronic
1084570616 11:69957464-69957486 CACCACTCACAGCGGGCAAAAGG - Intergenic
1085238297 11:75031973-75031995 AACCCCATGGAGCAGGCACAAGG - Intergenic
1086489641 11:87346230-87346252 CACCCCTGGGTTCAGGCACATGG - Intergenic
1087301813 11:96444429-96444451 CTCTCCACGTAGCAGGCACAGGG - Intronic
1088830669 11:113533547-113533569 CACCTCTCTCAGGAGGCAGAAGG - Intergenic
1089782440 11:120883089-120883111 CACCACTCTCAGCTGGCTCAGGG - Intronic
1091599862 12:1911622-1911644 CACCACCCGCAGGAGGCGCAGGG + Intronic
1092323378 12:7502880-7502902 CAATTCTCCCAGCAGGCACAGGG + Intronic
1092724850 12:11475117-11475139 AACCCCTGGGAGCAGCCACAGGG + Intronic
1092963852 12:13622699-13622721 CATCCCACGCAGAAGGCAGAAGG + Intronic
1093443815 12:19230741-19230763 CACCCCTCCCTGCAAGCAGAGGG + Intronic
1097781001 12:63704262-63704284 CAGCCCTCCCAGCCAGCACATGG + Intergenic
1099437289 12:82659603-82659625 CACACCTCCCAGCAAGCAGAGGG + Intergenic
1101319471 12:103660706-103660728 CACCCCTCACATCAGGAGCATGG + Exonic
1103510110 12:121467803-121467825 GGTCCCTTGCAGCAGGCACACGG + Intronic
1105701579 13:22939024-22939046 CACACCTCCCAGCAAGCAGAGGG + Intergenic
1108334118 13:49421515-49421537 CAGCCCACGCATCAGTCACAAGG + Intronic
1108485231 13:50917025-50917047 GACCCCTCCCAGCAGACACTGGG - Intronic
1108686690 13:52826247-52826269 CACACCTCCCAGCAAGCAGAGGG - Intergenic
1108713905 13:53060165-53060187 CAGGCCTGGCAGCAGGGACAAGG + Intergenic
1109420075 13:62100272-62100294 CACCCCTCGCAGGAGGGAATGGG - Intergenic
1109891122 13:68616702-68616724 CACCTCACCCAGGAGGCACAAGG + Intergenic
1113752077 13:112783492-112783514 CACTCCTCGCCGCAGGCACGGGG - Intronic
1114742208 14:25108959-25108981 CCCTCCTGGCAGCTGGCACAGGG + Intergenic
1116583580 14:46674248-46674270 ATCCCCTGGCAGCAGACACATGG + Intergenic
1117742580 14:58833903-58833925 CACACCTCCCAGCAAGCAGAGGG - Intergenic
1118592146 14:67409946-67409968 CACCCCTCCCTGCAGGCTGAAGG - Intronic
1118907020 14:70030668-70030690 CACCACCCACAGCAGGCAGAGGG - Exonic
1120827870 14:88971468-88971490 CACCCCTTGAAGCAATCACAGGG + Intergenic
1121488714 14:94342553-94342575 CACACCTCCCAGCAAGAACATGG + Intergenic
1121553438 14:94819412-94819434 CACCCATCCCTGCAGGCTCAGGG - Intergenic
1122313822 14:100813965-100813987 CTGCCCTCCCAGCAGGCAAAGGG + Intergenic
1123706042 15:22951711-22951733 GACCCCGCGCAGCACCCACAGGG + Intronic
1124508844 15:30305191-30305213 CACCCATGGCAGAAGGCAAAAGG + Intergenic
1124734714 15:32233471-32233493 CACCCATGGCAGAAGGCAAAAGG - Intergenic
1125739790 15:41954233-41954255 CCACGCTGGCAGCAGGCACAGGG - Intronic
1125974367 15:43937977-43937999 CACCGCTCCCAGCCTGCACATGG - Intronic
1126683498 15:51226563-51226585 CCCCCATCTCAGCAGGCACATGG + Intronic
1127373647 15:58362771-58362793 CACCTCACCCAGGAGGCACAAGG + Intronic
1128676521 15:69613382-69613404 CACCACTCGCTGCAGAAACAAGG - Intergenic
1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG + Intronic
1202955204 15_KI270727v1_random:71843-71865 CAGCCTGCGCAGCAGGCACTCGG + Intergenic
1132691318 16:1183075-1183097 CACCCCCAGCAGCAGGGACTGGG + Intronic
1132754406 16:1475501-1475523 CCGCCCTCGCAGTAGGCACTCGG + Exonic
1134803553 16:17106713-17106735 CACCCCCCGTCACAGGCACAAGG - Exonic
1138431552 16:56972275-56972297 GACCCCTCTCTGCAGGCACCAGG + Intronic
1140869464 16:79093549-79093571 CACCACCCGCAGCAGGCAGTGGG + Intronic
1141193572 16:81842655-81842677 CACCCCTGACACCAGGAACATGG - Intronic
1141200202 16:81891963-81891985 CCCAGCTCCCAGCAGGCACAGGG - Intronic
1142415990 16:89942406-89942428 CACACCTCCCAGCAGGAACATGG + Intergenic
1142433413 16:90042739-90042761 CACCCATCCCAGCAGAGACATGG - Intronic
1144047508 17:11467001-11467023 CACCCCTCTCAGTAGCTACAAGG + Intronic
1144441384 17:15285923-15285945 CAGCCCTCCCAGCATGCACATGG + Intergenic
1145257922 17:21337702-21337724 CGCCCCTCCCTGCAGGCTCATGG - Intergenic
1145318712 17:21750304-21750326 CACCCCTCCCTGCAGGCTCATGG + Intergenic
1146626555 17:34439577-34439599 CACCCCTCTCTGCAGGGAAAGGG + Intergenic
1147383853 17:40070693-40070715 CCACCCTAGCAGCAGGCAGAGGG + Intronic
1147904315 17:43813065-43813087 CACCCCTCTCAGTAGCCACCAGG + Intronic
1150211029 17:63441597-63441619 GACCCGTCCCAGCATGCACACGG + Intronic
1152688324 17:81705819-81705841 CACCCCACGCATCTGGAACATGG - Intronic
1152694121 17:81735227-81735249 CACACCTGGCGGCAGGAACAGGG + Intergenic
1152919770 17:83060244-83060266 CTCCCCTCACTGCTGGCACACGG + Intergenic
1153825147 18:8868180-8868202 CAGCCCAGGCAGCAGGCACGGGG - Intergenic
1154465162 18:14637280-14637302 CACCTCTTGCAGGAGGGACAAGG + Intergenic
1157888111 18:51388496-51388518 CACCCCACCCAGCAGTAACAAGG - Intergenic
1160240536 18:77119397-77119419 CACAGCACACAGCAGGCACATGG + Intronic
1161297647 19:3527811-3527833 CACCCCACGCAGCACCCACCTGG - Exonic
1161571351 19:5032389-5032411 CACCCCTCGGAGCAGGCCTGTGG - Intronic
1162720408 19:12658500-12658522 CTCCCCCAGCAGCAGGCAAAAGG - Exonic
1162937708 19:13989786-13989808 GACCCCTCCCAGCAGCCAGAGGG - Intronic
1163308241 19:16496079-16496101 CGCCACTCGCAGCATGCATATGG + Exonic
1164670052 19:30067330-30067352 CACCCCTGGCTCAAGGCACAGGG + Intergenic
1165638575 19:37364554-37364576 CACCTCCAGCAGCAGGCCCAGGG + Intronic
1165870838 19:38971981-38972003 CACCCCATGAAGTAGGCACATGG + Intronic
1166568879 19:43780907-43780929 CCCACCTCGCAGCACGCACAGGG + Exonic
1166739276 19:45104297-45104319 CACCCCTCCCAGGAGCCAGATGG - Intronic
1168095939 19:54114895-54114917 CACCCTTCGCAGCACCCACAGGG + Intronic
1168643942 19:58047828-58047850 CACCCCACCCAGAGGGCACAGGG - Intronic
927909584 2:26887425-26887447 CACACCTCCCCGCAGGCCCAGGG + Intronic
933332491 2:80911921-80911943 CACCTCTGGCAGCAGGATCATGG - Intergenic
933366767 2:81362910-81362932 CACCCCACCCAGGAAGCACAAGG - Intergenic
933531593 2:83518144-83518166 CACACCTCCCAGCAAGCAGAGGG - Intergenic
934750262 2:96789376-96789398 CCTCCCTCACAGCTGGCACAAGG - Intronic
936056724 2:109267581-109267603 CACCCATCACAGCCGGCACTCGG - Intronic
938945688 2:136210147-136210169 CCCCACTTGCAGAAGGCACACGG + Intergenic
941012822 2:160320681-160320703 CACTCCTGGCAGAAGGCAAAGGG - Intronic
941884579 2:170514954-170514976 CCCCCGTCGCAGCAGGTACGAGG + Exonic
942113661 2:172706925-172706947 CACCTCACCCAGCAGGAACAAGG - Intergenic
945443975 2:209913962-209913984 CAGCAGTGGCAGCAGGCACAGGG - Intronic
947743722 2:232496994-232497016 GACCCCTGGCAGCAGGCGCCTGG + Intergenic
948778355 2:240301721-240301743 GAACACTCACAGCAGGCACACGG - Intergenic
949045398 2:241870456-241870478 CGCCCCTCCCAGCTGGCACCCGG - Intronic
1168801850 20:648560-648582 CACCCCTCTCACCAGCTACAAGG - Exonic
1169630275 20:7622832-7622854 CACACCTCCCAGCAAGCAGAGGG + Intergenic
1173563413 20:44022169-44022191 CCCCCCTCTCAGCAGGGCCATGG - Intronic
1174385541 20:50186718-50186740 CACCCCACAAAGCAGGCAGATGG - Intergenic
1174419636 20:50391158-50391180 CACCCAGCAGAGCAGGCACAAGG + Intergenic
1175524229 20:59622578-59622600 CACCCCTCGCAGCAGGCACACGG - Intronic
1175728008 20:61332561-61332583 CACCCTGGGCAGCAGGCACTAGG + Intronic
1176023689 20:62975254-62975276 CACCCCACGCAGGAGCCACCTGG + Intergenic
1176256890 20:64157678-64157700 CACCCCTCGCAGTAGCCAGGGGG - Intronic
1176809376 21:13521106-13521128 CACCTCTTGCAGGAGGGACAAGG - Intergenic
1179983951 21:44910886-44910908 CACCCCCTGCAGCAGGGACAGGG - Intronic
1180600588 22:17012760-17012782 CAGCCCTCTCAGGAAGCACATGG + Intergenic
1180928326 22:19571438-19571460 CACCCCTTGGAGGAGGGACAGGG + Intergenic
1181051529 22:20240388-20240410 GACCCCTCCCATCAAGCACAGGG - Intergenic
1181762595 22:25068309-25068331 CCCCACTCCCAGCAGGCACTGGG - Intronic
1182577719 22:31284470-31284492 CACCATTAACAGCAGGCACATGG - Intronic
1183522712 22:38304676-38304698 CACTCCTCACAGCAGCCAGAGGG + Intronic
1184129479 22:42509251-42509273 CCCCCCTGGCAGCAGGGTCATGG + Intergenic
1184139680 22:42571344-42571366 CCCCCCTGGCAGCAGGGTCATGG + Intronic
1184160870 22:42696619-42696641 CCCAGCACGCAGCAGGCACATGG + Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1184471501 22:44698623-44698645 TGCCCCTGCCAGCAGGCACAAGG - Intronic
1184472689 22:44704592-44704614 CACCCCAGGCAGCAGGGGCACGG + Intronic
1184888878 22:47367473-47367495 CACCCCCTTCACCAGGCACAGGG - Intergenic
1185072918 22:48667105-48667127 CACCCCTCCCAGCATGCAGCAGG + Intronic
949472972 3:4415877-4415899 CTCCCCTGGCAGAAGGCAGAAGG - Intronic
950635873 3:14314157-14314179 CCCCCCTTGAAGCAGGCAGAGGG + Intergenic
951024906 3:17818071-17818093 CACACCTCCCAGCAGGCTGAGGG + Intronic
951255768 3:20447678-20447700 CACCTCCAGCAGCAGGCCCAGGG - Intergenic
952519575 3:34143082-34143104 CACCCATGGCAGAAGGCAAAGGG - Intergenic
953023445 3:39130555-39130577 CACTCCTCCCAGCTGGCACAGGG - Intronic
953385790 3:42505001-42505023 CCCCCCGGACAGCAGGCACAGGG + Intronic
953886995 3:46719743-46719765 CACCGCTCACAGGAGCCACAGGG + Exonic
954332947 3:49900585-49900607 CACCCCAAGCTGTAGGCACAAGG - Intronic
955203634 3:56875796-56875818 CATCCCTAGCACCTGGCACAAGG - Intronic
956459177 3:69454412-69454434 CACACCTCCCAGCAAGCAGAGGG - Intronic
958548634 3:95588923-95588945 CACACCTCCCAGCAAGCAGAGGG + Intergenic
958631311 3:96686633-96686655 CACCCCTGGCAGTGGCCACATGG - Intergenic
960479496 3:118171371-118171393 CACACCTCCCAGCAAGCAGAGGG - Intergenic
960762601 3:121090317-121090339 CACCCCACCCAGCAGCTACAAGG - Intronic
962320385 3:134385172-134385194 CACCGCTCGCTGCAGGCACCTGG + Intergenic
962343914 3:134606244-134606266 CACCCCACACAGCAGCCCCAGGG + Intronic
963008897 3:140751159-140751181 CACCCCTCCCAGCAGGCTGTGGG + Intergenic
963434492 3:145250587-145250609 CACCCCTGGCAGCAAAGACATGG - Intergenic
963533222 3:146497273-146497295 CACACCTCCCTGCAAGCACAGGG - Intergenic
964746689 3:160019278-160019300 CTCCTCTCGCCGCAAGCACATGG + Intronic
965237003 3:166137008-166137030 GGCCCCTGGCAGCAGCCACATGG - Intergenic
965586946 3:170327416-170327438 CACACCTCCCAGCAAGCAGAGGG - Intergenic
968334215 3:197899914-197899936 ACCCCCTGGCAGCAGCCACACGG + Intronic
968487779 4:872237-872259 CACCCCTCAGGGCGGGCACAGGG - Intronic
968664449 4:1813439-1813461 CACCCCACCCAGAGGGCACAGGG + Exonic
969148152 4:5142145-5142167 CTCCCCAAGCAGCAAGCACAAGG - Intronic
969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG + Intronic
969535585 4:7754660-7754682 CGCCTCTCCCAGGAGGCACAGGG + Intergenic
969636054 4:8370160-8370182 CAGCCCGAGCAGCAGGCACAAGG + Intronic
970963220 4:21897907-21897929 ATCCCCTGGCAGCAGGCACGTGG + Intronic
971137577 4:23886496-23886518 GATCCCTGGCAGCAGGGACAAGG + Intronic
974838271 4:67275629-67275651 CACACCTCCCTGCAGGCAGAGGG + Intergenic
976222995 4:82773115-82773137 TACCCCTCGAAGCTGGCATAGGG - Intronic
976451999 4:85200488-85200510 CACCCCTGGCAGCTGCCACATGG - Intergenic
978287697 4:107098281-107098303 ATCCCCTGGCAGCAGTCACATGG + Intronic
980184606 4:129446217-129446239 CACCCCTCCCACCAGGAACTCGG - Intergenic
980595475 4:134948536-134948558 CACCCCTCCCCGCAAGCAGAGGG + Intergenic
981170271 4:141615484-141615506 CACACCTCCCAGCAAGCAGAGGG - Intergenic
981470703 4:145131394-145131416 CTCCCCTGGCAGAAGGCAAATGG - Intronic
981944921 4:150330494-150330516 CACCCCTCCAAGCAGGTCCATGG - Intronic
983585017 4:169345276-169345298 GACCCCACACAGCAGGCACAGGG + Intergenic
984263089 4:177465145-177465167 CACCGCGCCCAGCCGGCACAGGG + Intergenic
984995116 4:185423145-185423167 CACCGCGCCCAGCTGGCACAGGG + Intronic
985881677 5:2643065-2643087 GACCCCAGGCAGCGGGCACAGGG - Intergenic
985965409 5:3335710-3335732 CACCCCACGCAGGAGGTAGAAGG + Intergenic
988020563 5:25614941-25614963 CACACCTCCCAGCAAGCAGAGGG + Intergenic
988500087 5:31777077-31777099 CACACCTCCCAGCAAGCAGAGGG - Intronic
990512195 5:56499041-56499063 CACACCTCCCAGCAAGCAGAGGG + Intergenic
991596929 5:68315799-68315821 CTCCCTTCAAAGCAGGCACAGGG + Intergenic
992098288 5:73381981-73382003 CACGCCTCCCAGCAGGCCCGGGG - Intergenic
993260110 5:85647224-85647246 CAACCCTCGAACCAGGAACAAGG - Intergenic
994251567 5:97542264-97542286 CACCCCTCCCCGCAGGCTGAGGG + Intergenic
994825932 5:104712810-104712832 CATCCCTCCCAGCAGAGACATGG - Intergenic
995096248 5:108239349-108239371 ATCCCCTGGCAGCAGCCACAAGG + Intronic
999155322 5:149453670-149453692 CACCCTCAGCAGCTGGCACAGGG + Intergenic
999986080 5:157006858-157006880 CACTCATGGCAGAAGGCACAAGG + Intergenic
1000547565 5:162621818-162621840 CACACCTCGCCGCAGGCTGAGGG - Intergenic
1001791761 5:174463777-174463799 CACCCCTGGCAACTGGCACAGGG + Intergenic
1001973768 5:175979525-175979547 CACCCCACGCAACAGGGCCAGGG + Intronic
1002243664 5:177864254-177864276 CACCCCACGCAACAGGGCCAGGG - Intergenic
1003901549 6:10659861-10659883 CACACCTCCCAGCAGGCTGAGGG - Intergenic
1004979757 6:21010476-21010498 CATCACTTGCTGCAGGCACAAGG + Intronic
1007361267 6:41358160-41358182 CACCCCTACCAGCAGTCAGAGGG + Intergenic
1007627995 6:43257286-43257308 CATCCCTAGCAGCCAGCACAGGG - Intronic
1012598816 6:101070238-101070260 CACACCTCCCAGCAAGCAGAGGG - Intergenic
1013306232 6:108848908-108848930 GACCCCTGACAGCATGCACAGGG - Intronic
1013472293 6:110476380-110476402 CACCCCGCGCAGTCGGGACACGG - Intronic
1013820907 6:114152782-114152804 CATCCCTCGCAGTAGAGACAGGG - Intronic
1016937386 6:149457236-149457258 CCCCTATCGCAGCAGGCACAGGG + Intronic
1017383560 6:153857304-153857326 CACACCTCCCGGCAGGCAGAGGG + Intergenic
1017690979 6:156964044-156964066 CACCCTTGGAAGCAGTCACAAGG + Intronic
1017924859 6:158901879-158901901 CACCCCCGGCAGCAGCCATATGG - Intronic
1018983660 6:168618805-168618827 CTCTCGACGCAGCAGGCACACGG + Intronic
1019431354 7:1001274-1001296 CAGCGCTCACAACAGGCACAGGG - Intronic
1019449590 7:1090444-1090466 CCCCACTCGCAGCAGGGCCAGGG + Intronic
1019450574 7:1095649-1095671 CACCCCTCACAGCAGCCCCGTGG + Intronic
1019612982 7:1946212-1946234 CACCTCTAGCTGCAGGCCCAGGG + Intronic
1020016320 7:4834162-4834184 GGCCCCTGGCAGCAAGCACAGGG + Intronic
1021723835 7:23531477-23531499 CACACCTCGGAGCAGACATAAGG + Intronic
1022704485 7:32789711-32789733 GAGCCCTGGCACCAGGCACAGGG - Intergenic
1022908658 7:34879455-34879477 GACCCCTGGCACCAGGCACAGGG - Intergenic
1022939583 7:35220322-35220344 CAGCCCTCCCAGCCAGCACATGG + Intronic
1024016893 7:45325465-45325487 CACCCCTGCCAGCAGGCATGAGG - Intergenic
1026152879 7:67803021-67803043 CCACCCTCACAGCAGGCATATGG + Intergenic
1026153020 7:67803952-67803974 CCACCCTCACAGCAGGCATATGG - Intergenic
1026910641 7:74089866-74089888 CCCCCCTCACCGCAGACACAGGG - Intronic
1028307859 7:89289499-89289521 CACCCCTAGCAGCAGCCATGTGG + Intronic
1029596368 7:101539614-101539636 CACCACTCCCAGCCAGCACAGGG + Intronic
1029968222 7:104762871-104762893 CAAGCCTGGCAGCAAGCACATGG + Intronic
1030517128 7:110551976-110551998 CAATCATCGCAGCAGGCAAAAGG + Intergenic
1031033031 7:116755371-116755393 CACCCCTTGAAGGAGGGACAAGG + Exonic
1033026833 7:137782419-137782441 CATCCCCCACAGCAGCCACAGGG + Intronic
1033368180 7:140687132-140687154 CACCAGTCGCAGCGGGCAGAGGG - Exonic
1035283473 7:157792194-157792216 CACACCTTGCAGAAGGCAGATGG - Intronic
1037982140 8:23261808-23261830 CACCTCAGGCAGCAGGGACAGGG - Exonic
1040275425 8:46011368-46011390 CACCCCCTGCAGTGGGCACAGGG - Intergenic
1041588328 8:59547096-59547118 CACCCCTCCCGGCAAGCAGAGGG - Intergenic
1042645321 8:70980205-70980227 CACCCCACCCAGGAAGCACAAGG - Intergenic
1043621080 8:82192635-82192657 CACACCTCCCAGCAAGCAGAGGG + Intergenic
1045933694 8:107655580-107655602 CACACCTCCCAGGAAGCACAGGG - Intergenic
1046009416 8:108528289-108528311 CACACCTAGAAGCAGGCAAAAGG - Intergenic
1049425444 8:142535995-142536017 CACCCCTCTCATCAGGCAGATGG - Intronic
1049617622 8:143582548-143582570 CACCCCACACAGCAGGCCCAAGG + Intronic
1049973555 9:841773-841795 CATCCCTCGCAGCAGTCTCCAGG + Exonic
1050205496 9:3191932-3191954 CAGCCCTCTCAGCAGGTACCTGG - Intergenic
1050350961 9:4741055-4741077 CACCGCTCGCAGCAGCCGCGCGG + Exonic
1051121515 9:13757154-13757176 CAAACATCGCATCAGGCACAGGG - Intergenic
1051842467 9:21414035-21414057 CATCCCTAGCAGCAGCCACATGG - Intronic
1059447524 9:114347990-114348012 GTCCCTTCACAGCAGGCACAGGG + Intronic
1060304373 9:122397734-122397756 GATCCCTGGCAGCAGCCACATGG + Intergenic
1060317040 9:122521561-122521583 CACTCCTTGCTGCAAGCACAGGG + Intergenic
1061413001 9:130431181-130431203 CCTCCCTCTCAGCAAGCACAGGG + Intronic
1062254049 9:135612816-135612838 CACCCCTGGCCACAGGCACAGGG - Intergenic
1062349595 9:136132534-136132556 CACCCCTGGCTGCAGGGACGCGG - Intergenic
1185621596 X:1453733-1453755 CTCCCCTCCCACCAGGCACGAGG - Intronic
1185621753 X:1454122-1454144 CGCCCCTCCCACCAGGCACGCGG - Intergenic
1186992897 X:15088599-15088621 CACCTCACCCAGCAAGCACAAGG + Intergenic
1188651424 X:32635198-32635220 CATCCATGGCAGCAGTCACATGG - Intronic
1194606524 X:95985601-95985623 CACCCCTGGCAGCAGCCTCATGG - Intergenic
1197468478 X:126837139-126837161 CTCCCCTGGCAGCAGGCATGTGG + Intergenic
1198882297 X:141294764-141294786 ACCCCCTAGCAGCAGCCACATGG + Intergenic
1198932814 X:141879157-141879179 CAGAGCTGGCAGCAGGCACAGGG - Exonic
1198935988 X:141903379-141903401 CATGGCTGGCAGCAGGCACAGGG - Intergenic
1198960342 X:142175662-142175684 CAGAGCTGGCAGCAGGCACAGGG + Intergenic
1199026816 X:142949308-142949330 CACCCCTAGAAGCAGCCTCATGG + Intergenic